The Use Of Gfp And Its Effects On The Levels Of The Peaks Essay

The Use Of Gfp And Its Effects On The Levels Of The Peaks Essay

Length: 1752 words (5 double-spaced pages)

Rating: Better Essays

Open Document

Essay Preview

When the chromatographs were analyzed for all five sequences, it was found that the peaks were uniformly distributed signals and the peaks did not have double peaks nor did they overlap. The peaks started out strong (seen from the sharpness and height of the band) but after about 600 base pairs (bp), the intensity of the peaks began to decrease. The sequence for each sample was selected and analyzed using Addgene. Primer locations (forward and reverse) along with multiple cloning site, open reading frames and orientation of sequence in plasmid were found using Addgene. The forward primer was 5’ CAGATGTCCACAATGGGAAACG 3’ and the reverse primer was 5’ ATACGATGAGGACCAGCTTCTTG 3’ and these sequences were used to determine where the primers annealed and produced the Calcineurin product. The presence of GFP was also determined using linear maps; if the linear map had a red arrow, GFP was being expressed. If the arrow was blue, either the GFP was not expressed or the sequence for GFP was not found in the region of the sequence used for analysis. After the sequence was analyzed, BLAST was used to compare the sequence with Calcineurin (NM_147180.3) and other sequences in the database. Another name for Calcineurin is Homo sapiens protein phosphatase 3 regulatory subunit B, beta. This name was seen during some BLAST results instead of Calcineurin.
Approximately 583 base pairs of sequence one was highlighted and analyzed using the linear map of the plasmid (Figure 4). The multiple cloning site (MCS) was found from 79bp to 127bp and the GFP was found to be from 128bp to 571bp. There was only one reading frame present, which suggests that there was no stop codon present between the Calcineurin PCR product and the GFP sequence present in the p...


... middle of paper ...


... to verify the presence of the insert because the restriction enzyme would uniquely cut (cut in only once place) the plasmid at specific locations and produce two bands. The insert size is 522bp and the plasmid is 6156bp resulting in a total 6678 bp. For verification, the plasmid could be cut using BglII and BstBI and this would result in two bands; the plasmid would be about 5481bp and the insert would be about 1197bp. There would be 4 controls with this: the plasmid without enzymes, the plasmid with insert without enzymes, the plasmid with insert with BglII and the plasmid with insert with BstBI. The samples, when loaded on an agarose gel and through electrophoresis, would result in bands to verify that not only did the enzymes would, but the insert was actually in plasmid and this would be seen when the gel is analyzed through chemiluminescence such as SYBR safe.

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

the san francisco peaks Essay example

- In 1629, a group of Franciscans stationed at the village of Oraibi named the giant mountains they saw San Francisco, in honor of St. Francis of Assisi . Opinions over the use of the peaks by Native tribes and this new influx of culture are as far apart as the names they call the mountain itself. At over a mile high, the San Francisco Mountains tower over the predominantly Anglo town of Flagstaff to the south. The mountain range was actually formed by a volcano that is now inactive. These peaks have long been considered sacred ground by thirteen Native American tribes, including the Hopi and the Navajo....   [tags: Native American Studies]

Better Essays
1493 words (4.3 pages)

Effects of Daily Media Use on Youth Obesity Essay

- As according to a study done by the Kaiser Family Foundation, “8-18 year-olds devote an average of 7 hours and 38 minutes...to using entertainment media across a typical day”. Not only that, but most youths also report to having no rules governing the amount of time spent on entertainment media in the mediums of TV, videogames, and any computer use. Less than 50% actually have rules and regulations on what video games they are allowed to play and what TV shows they can watch. However, I believe that daily media use among children and teens needs to be controlled....   [tags: child obesity, media use, video games]

Better Essays
922 words (2.6 pages)

Molecular Biology And Expressing Gfp Essays

- November 14, 2016 Abigail Lammers Molecular Biology Marion Kawar Introduction: This lab dealt with molecular biology and expressing GFP in bacterial cells. Most of the lab dealt with plasmids. Plasmids are short, circular pieces of DNA that can be used to transmit genetic information into a host cell (for example: adding a gene that will make the host cell glow). These DNA pieces are separate from the rest of the genome and are replicated separately as well. Plasmids join to a DNA sequence through bacterial transformation....   [tags: DNA, Bacteria, Gene, Molecular biology]

Better Essays
2102 words (6 pages)

Essay on Drug Use Among Student Athletes

- June 1995, the Supreme Court of the United States passed a law to randomly drug test students involved in extracurricular activities or sports. A voting decision of 6 to 3 set the law into place. In today’s society, teenagers and young adults become victims of drug abuse and addiction. Young student athletes find themselves faced with low self-esteem, peer pressure, and anxiety. Student athletes fill the void in their lives with the illegal use of drugs (including steroids) and alcohol. Should school officials have the authority to randomly administer drug testing on student athletes....   [tags: Drug Use]

Better Essays
862 words (2.5 pages)

Essay Teenage Marijuana Use

- ... Both theories go hand in hand. The stress that causes teens to start smoking might be caused by social reasons, for example having no friends, trying to fit in, etc. Both points of view neglect to include what causes the teenage smokers that are the ones giving it to their friends, the ones that are popular and aren’t stressed. Today’s research is only done on a specific group of teens not the remaining individuals and why they started and currently smoke marijuana. What the developmental issues regarding smoking marijuana as a teen: It seems every decade marijuana studies show that it has no side effects on users, in turn it become more available like when some states in America had leg...   [tags: causes and effects]

Better Essays
856 words (2.4 pages)

Essay on Effects of Automobiles

- Effects of Automobiles Think for a second here, what do you use almost every day to get to where you need to go. An automobile is probably what you are thinking of because just about everyone has one. Automobiles have become so common; nine out of every ten families in the United States own some type of vehicle. Now Imagine going through everyday life without one it would be nearly impossible. Automobiles have had a very positive impact on the world and on many people’s lives. However they have also taken quite a negative effect on the world and in life....   [tags: Negative Effects, Positive Effects, Vehicles]

Better Essays
1302 words (3.7 pages)

Essay on Language, Imagery, and Symbolism in To Be of Use

- Use of Language, Imagery, and Symbolism to Develop the Theme of  To Be of Use                            In the minds of most people, the words, "hard work" and "heavy labor" carry a negative connotation.  What these words imply is not something that is generally welcomed with enthusiasm but is often accepted either by force or obligation.  Marge Piercy's poem "To Be of Use" conveys an opposing connotation about the idea of work.  The central theme of the poem is that satisfaction, gratification, and self-fulfillment can be attained by using one's capabilities to serve a functional purpose in life, for it is the opinion of the speaker that an idle existence has no value or significance b...   [tags: To Be of Use]

Better Essays
1171 words (3.3 pages)

Essay about Anabolic Steroid Use in the Olympics

- Canadian track star Ben Johnson was denied his gold medal in the 1988 Olympics after he tested positive for anabolic steroids. This incident sparked worldwide attention to the extent of anabolic steroid use. To date, the International Olympic Committee has barred the use of seventeen anabolic steroids. Other organizations, including The National Football League, National Collegiate Athletic Association's International Amateur Athletic Federation, and the International Federation of Body Builders have followed suit....   [tags: Anabolic Steroids Use by Athletes]

Free Essays
1891 words (5.4 pages)

Use of Steroids in Sports Essay

- When athletes compete for excellence in sports, the use of steroids or other supplements often times may be a cause for disqualification in a sports event. Many athletes today subscribe to the idea that steroids should be allowed in sports competition. They admit that steroid and supplement use enhances natural athletic ability and endurance and, thus, promotes athletes to perform better in competition. These same athletes are convinced that doctors and the government advance the “side effect” argument mostly as a scare tactic to preserve the “purity of athletic competition....   [tags: Anabolic Steroids Use Athletics]

Free Essays
1977 words (5.6 pages)

Drug Use in Sports Essay example

- Drugs in sports can cost a player his or her scholarship(s) and more seriously, their lives. Everyday athletes that you may not think are doing anabolic steroids or the human growth hormone are the athletes who are the big users. 1. There are three major performance enhancing drugs that are used by the super star athletes: anabolic steroids, amphetamine, and the human growth hormone pills. 2. These performance enhancing are found in just about all fifty states and the problem is rapidly growing....   [tags: Athelets Drug Use Sports]

Better Essays
2295 words (6.6 pages)