Essay about The Zebra Fish and Human Diseases

Essay about The Zebra Fish and Human Diseases

Length: 1477 words (4.2 double-spaced pages)

Rating: Powerful Essays

Open Document

Essay Preview

1.0 Introduction
1.1 Zebra Fish
The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8).
1.2 Polymerase Chain Reaction (PCR) and RT-PCR
Polymerase Chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated it is able to be copied as much as needed (2). In this experiment PCR was used to isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows:
5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’
5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’
Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2).
Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe expression levels of RNA (10). Using RT-PCR one is capable of identifying a predetermined gene (vangl2) via complementary Deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcribing its cDNA through the enzyme reverse transcriptase (10).
1.3 Gel Electrophoresis.
F...


... middle of paper ...


...udhry B., Copp A.J., Henderson D.J. (2005) “Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract, n.d. Web. 11 March 2014

6. Borovina, Superina, Voskas, Cirunia. (2010) “Vangl2 directs the posterior tilting and asymmetric localization of motile primary cilia, n.d. Web. 15 March 2014

7. Ingham P. (2009) “The power of the zebrafish for disease analysis, n.d. Web. 15 March 2014

8.Wen Z. (2013) “The zebrafish model: use in studying cellular mechanisms for a spectrum of clinical disease entities, n.d. Web. 15 March 2014
9.Bustin SA, Benes V, Nolan T, Pfaffl MW (June 2005). "Quantitative real-time RT-PCR-- a perspective". J. Mol. Endocrinol. Mon. 21 April 2014
10. Bustin SA (October 2000). "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays". J.

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

Fish Protein Has Been A Mainstay For The Human Diet Essay

- Fish protein has been a mainstay for the human diet for centuries. However, aquaculture, which is the practice of raising fish such as salmon in controlled conditions, as opposed to the commercial fishing industry, which is procurement of wild fish from their natural environment, made its debut in the United States as a commercial enterprise in the late 1970’s according to the Eco - Justice Marketplace Project.(n.d.). This mode of salmon procurement began to develop in the late eighteenth and early nineteenth century, as a response to the declining populations of native wild fish such as salmon and trout....   [tags: Salmon, Aquaculture, Fish, Fish farming]

Powerful Essays
1299 words (3.7 pages)

Essay on Preventing The Human Race Of Emergency Diseases

- The world has been plagued by many different diseases since the beginning of time (Knauer). All the diseases so far have been stopped before they wiped out the human race. Scientists prepare for the worst epidemics in order to prevent the human race from being extinguished completely. However, scientists have yet found a way to stop the diseases before millions suffer and die. Can future epidemics be stopped with modern medicine and technology. Scientists and disease prevention centers take extra precautions for state of emergency diseases, like Ebola (66)....   [tags: Infectious disease, Epidemiology, Human]

Powerful Essays
1049 words (3 pages)

The Poem ' The Fish ' Essay

- In the poem “The Fish”, the use of short lines and the presence of enjambments indicate that the poet, Bishop, is giving her own thoughts. This form of poetry gives the impression that the poet is not simply writing the words on a piece of paper but is rather speaking them out loud. The poem is presented in a way that the audience feels as if the poet was present at the scene and was narrating the events that occurred throughout the poem (Bishop 463). The poem is also written as a single stanza....   [tags: Fishing, Fish, Ayumi Hamasaki, Fisherman]

Powerful Essays
1274 words (3.6 pages)

Essay The Poem ' The Fish '

- In the poem ‘The Fish’, the use of short lines and the presence of enjambments indicate that the poet, Bishop, is giving her own thoughts. This form of poetry gives the impression that the poet is not simply writing the words on a piece of paper but is rather speaking them out loud. The poem is presented in a way that the audience feels as if the poet was present at the scene and was narrating the events that occurred throughout the poem (Bishop 463). The poem is also written as a single stanza....   [tags: Fishing, Fish, Ayumi Hamasaki, Fisherman]

Powerful Essays
1274 words (3.6 pages)

Analysis Of The Poem ' The Fish ' Essay

- Understanding ‘The Fish’ Essay In the poem ‘The Fish’, the use of short lines and the presence of enjambments indicate that the poet, Bishop, is giving her own thoughts. This form of poetry gives the impression that the poet is not simply writing the words on a piece of paper but is rather speaking them out loud. The poem is presented in a way that the audience feels as if the poet was present at the scene and was narrating the events that occurred throughout the poem (Bishop 463). The poem is also written as a single stanza....   [tags: Fishing, Fish, Fisherman, Audience]

Powerful Essays
1294 words (3.7 pages)

Setting up a Fish Tank Essay

- Saving Nemo Fish keeping may seem like a fun and easy hobby, but without the proper research and knowledge one will kill the fish rather than keep them. Most people think keeping fish is an easy hobby because all you have to do is buy a tank and the fish to put in the tank, but they are extremely wrong. Fish are very hard to care for, and they are also very temperamental to changes within the tank. Fish require constant care and a watchful eye of the water conditions in the tank. If the water condidtions in the tank are not set up properly, or if there is a spike or sudden change in the water conditions it could cause the fish to become sick or even kill the fish....   [tags: fish keeping hobby]

Powerful Essays
1172 words (3.3 pages)

The Similarities Between Humans and Fish Essay

- Human and fish are not closely related on the outside. Most people would not see how we can share same features with fishes, but scientists do know that these two species share homologous features. These features imply that human and fish are related in the lineage of chordate because human shared homologous features with fish. Homologous features shared by human and fish lighten up the evolutionary pathway from the earliest vertebrate by sharing similar structures of the hands and fins. The development of teeth that diversified into features that showed up from the skin, and down to the instruction that made us who we are....   [tags: vertebrate, fish, homologous features]

Powerful Essays
886 words (2.5 pages)

Emerging Infectious Diseases And Its Effects On Human Behavior Essay example

- Emerging infectious diseases can be defined as infections that have newly appeared in a population or have existed but are rapidly increasing in incidence or geographic range. More than 36 new emerging infectious diseases have been identified worldwide since 1973, identified by WHO and CDC (Center for Disease Control and Prevention). Among recent examples are HIV/AIDS, Hantavirus pulmonary syndrome, Lyme disease, and hemolytic uremic syndrome (a food borne infection caused by certain strains of Escherichia coli)....   [tags: Infectious disease, Epidemiology, Infection]

Powerful Essays
996 words (2.8 pages)

Essay about The Zebra Mussel

- Populations of the zebra mussel, Dreissena polymorpha (Pallas), were first found in the Laurentian Great Lakes in 1988 (Hebert et al., 1989). This species is native to the Caspian, Aral, and Black Seas and the rivers that drain into them but has spread throughout Europe, principally during the 18th century. Since it is restricted to estuarine and freshwater habitats, it is presumed that it was introduced into North America by ballast waters of transoceanic vessels. Based on the substantial amount of genetic variation found in these initial populations, as estimated from electrophoretic variation of allozymes, the colonization of the Great Lakes was by a large number of immigrants and...   [tags: essays research papers]

Powerful Essays
624 words (1.8 pages)

Elizabeth Bishop’s “The Fish” Essay

- “The Fish,” written by Elizabeth Bishop in 1946, is perhaps most known for its incredible use of imagery, but this analysis does not merely focus on imagery. Instead, it is based on a quote by Mark Doty from his essay “A Tremendous Fish.” In it he says, “‘The Fish’” is a carefully rendered model of an engaged mind at work” (Doty). After reading this statement, it causes one to reflect more in-depth about how the poem was written, and not just about what its literal meaning lays out. In “The Fish,” Bishop’s utilization of certain similes, imagery in the last few lines, narrative poem style, and use of punctuation allows the audience to transport into the life of the fish; therefore, allowing...   [tags: Literary Analysis, The Fish, Elizabeth Bishop]

Powerful Essays
961 words (2.7 pages)