Genetic Modification Of Organisms : A Gene Recipient Essay

Genetic Modification Of Organisms : A Gene Recipient Essay

Length: 1447 words (4.1 double-spaced pages)

Rating: Strong Essays

Open Document

Essay Preview

Genetic Modification of organisms starts with two organisms, a gene recipient, and a gene donator. The recipient may be an animal, say a cow, however, it can also be a plant, like corn. The donor can be an animal or plant as well. The donor must have a gene sequence that has starting and ending codons exactly the same as the recipient. For example:
The donor has a gene that makes the recipient last longer under adverse conditions. The gene sequence is as follows:
CAAGGCGCGTATCAGTTCGTCG
GTTCCGCGCATAGTCAAGCAGC
The bolded letters are the actual gene, which are made of codons. Codons are a three base long string of the DNA bases (CGTA, Which must match up with it’s complement. C to G, T and A,) which tells the body how it should repair itself, or fix itself. The recipient must have the same codons outside of the gene, due to genetic mutations, which can easily kill the recipient. Scientists cut out this gene, taking careful note of the codons around this gene. Scientists then cut out an unused or inactive gene in the recipient, with the exact same gene sequence around the gene. In the example above, the two bases G and C and the other two bases T and A. The recipients genes can look like such:
TCAGGATAGCTAATCGGCATCGATA
AGTCCTATCGATTAGCCGTAGCTAT
The bolded and underlined bases are the required codons to make it into the recipient’s gene sequence. Cutting out the italicized gene, and replacing it with the donor’s gene now makes it so the recipient has this gene.
It will not be in an instant that you can see the results. Most studies have shown that it takes between two and five generations of the organism to show these new effects. Even though it may take a few generations of the organism, it helps farmers significantly.

Gen...


... middle of paper ...


... the bad lifestyle.

The pancreas is the workhorse of sugar use. It allows for sugars in the blood to be used in cells. This happens by the pancreas creating insulin, which allows the body to take in blood sugar.
Type Two Diabetes is the most common form of diabetes. In general, diabetes has to do with your bodies inability to produce insulin to regulate sugar intake, to process body sugars, or some other type along the similar basis. However, most of the other types of diabetes is caused by hereditary reasons, type two diabetes is caused by diet.
This is caused by, essentially, flooding your system with the different types of sugar. (Glucose, Sucrose, Fructose, etc.) Your pancreas slows its production of insulin significantly, to the point when your body cannot allow the sugars into your cells. This means that your body can very easily go into shock, and kill you.

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

Genetic Modification of Food Essay

- ... GM crops may be less susceptible to insect related diseases or viruses and may tolerate herbicides better. A gene originating in bacterium Bacillus thuringiensis (Bt) produces a toxin. It can be introduced into plants to make them more insect-resistant. Introducing genes from disease-causing viruses into the plants enables them to develop a resistance to the viruses. Some bacteria have specific genes, which make them resistant to herbicides. Consequently, introducing this gene into plants makes them more resistance to some herbicides....   [tags: genetic engineering, GMOs, biotechnolgy]

Strong Essays
3180 words (9.1 pages)

Genetic Modification : Genetically Modified Organisms Essay

- Genetic modification is made possible due to the common genetic language of all organisms – DNA. Most of the genetic modifications were done based on this mechanism: a gene that codes a desirable trait is extracted from one organism and inserted into another unrelated organism, and if it is done correctly, the new foreign gene can be read and understood by the gene recipient even if these two species are unrelated. The product of such is then called genetically modified organism, also known as transgenic....   [tags: Genetically modified food]

Strong Essays
1236 words (3.5 pages)

The Morals and Ethics of Genetic Engineering Essay

- Introduction Widely considered a revolutionary scientific breakthrough, genetic engineering has been on a path toward changing the world since its introduction in 1973 by Stanley Cohen and Herbert Boyer (What). However, as genetic engineering slowly permeates the lives of humanity, the morals and ethics behind what are now common practices are entering public attention, and as a culture we are left to question whether the change brought on by such a discovery bring benefits and positive change, or damage and destruction....   [tags: genetics, theology, bioethics, DNA, GMOs]

Strong Essays
3322 words (9.5 pages)

Essay on Benefits of Genetically Engineered Food

- The scientific breakthrough of genetic engineering can completely alter human history. Genetic engineering, also known as genetic modification, transforms genetic material in living organisms in order to produce desirable traits. Although the manipulation of genetic material in food seems uncommon, over majority of food contain ingredients that were genetically altered. The entire world’s food supply can potentially be modified to produce more desirable traits in both plants and animals. There are absolutely zero negative health risks associated with genetically modified food and numerous researches conducted before releasing a genetically modified food to the public....   [tags: modification, desirable food]

Strong Essays
1104 words (3.2 pages)

Genetically Modified Organisms in Our Food Essay

- Genetically modified organism (GMO) is a technique that uses genetic engineering (GE), such as recombinant DNA technology and reproductive cloning. This modifies yeast, insects, fish, mammals, plants, crops, and microorganisms. Biotechnology companies play a large role in the use of GMOs. The leading superpowers are USA (The Superpower), European Union (2nd World), Japan (The Sun), China (The Dragon), India (The Elephant) and South Korea, Taiwan, Hong Kong, and Singapore (The Small Dragons). GMO is the altercation of genetic material (DNA)....   [tags: Crops, DNA, Genetics]

Free Essays
2545 words (7.3 pages)

Genetic Engineering : The Modification Of An Organism Essay

- Genetic engineering (GE) is the modification of an organism’s genetic composition by artificial means, often involving the transfer of specific traits, or genes, from one organism into a plant or animal of an entirely different species. When gene transfer occurs, the resulting organism is called transgenic or a GMO (genetically modified organism). Genetic engineering is different from traditional cross breeding, where genes can only be exchanged between closely related species. With genetic engineering, genes from completely different species can be inserted into one another....   [tags: DNA, Genetic engineering]

Strong Essays
1330 words (3.8 pages)

Genetic Engineering in Agriculture Essay

- Genetic Engineering in Agriculture Among the millions of species that inhabit the planet, only twenty species provide ninety percent of the human food supply (Montgomery 2000). Since the introduction of genetic engineering, however, livestock and crops have a more productive future. Transfer of engineered genes from organism to organism occurs through hybridization, conjugation, and transformation in microorganisms. By the substitution of genes into agricultural species, biodiversity can flourish to improve social and economic development....   [tags: Papers]

Strong Essays
3421 words (9.8 pages)

Genetic Modification : A Controversial Issue Essay

- Final Essay When it comes to the topic of genetic modification, most of us will readily agree that it is a controversial issue. Where this agreement usually ends, however, is on the question of should we continue researching different applications of genetic modification, and allow it to be used on humans. Whereas some are convinced that genetic modification is another step in human development, just like vaccinations, others maintain that it is a slippery slope. I am of two minds, one being that genetic modification could lead to further class separation, sex ratios being off balance, physiological trauma in the modified child, and mistakes being made in the DNA sequence....   [tags: DNA, Genetics, Genetic disorder]

Strong Essays
1892 words (5.4 pages)

Ethics of Genetic Modification Technology Essay

- Modern society is on the verge of a biotechnological revolution: the foods we eat no longer serve simply to feed us, but to feed entire nations, to withstand natural disasters, and to deliver preventative vaccination. Much of this technology exists due to the rapid development of genetic modification, and today’s genetically modified crops are only the tip of the proverbial iceberg. Says Robert T. Fraley, chief technology officer for biotech giant Monsanto, “It’s like computers in the 1960s. We are just at the beginning of the explosion of technology we are going to see." Biotechnology’s discontents are numerous and furious, declaring the efforts of corporations of Monsanto to be dangerous...   [tags: Genetic Engineering]

Strong Essays
776 words (2.2 pages)

Can Genetic Modification Benefit Humanity? Essays

- Throughout the course of human history, new technological advancements have always created opposing views, and conflict between the different groups that hold them. Today, one of the greatest technological controversies is over the morals and practicality of genetically modifying crops and animals. Reasons for doing so vary from making them more nutritious to making plants more bountiful to allowing organisms to benefit humans in ways never before possible. Genetic engineering is a process in which genes within the DNA of one organism are removed and placed into the DNA of another, a “…reshuffling of genes…from one species to another” (Steinbrecher qtd....   [tags: Genetic Engineering]

Strong Essays
1676 words (4.8 pages)