Genetic Modification : Genetically Modified Peaches Essay examples

Genetic Modification : Genetically Modified Peaches Essay examples

Length: 1948 words (5.6 double-spaced pages)

Rating: Strong Essays

Open Document

Essay Preview

Genetic modification of plants has occurred for hundreds of years, as farmers want to improve yields and decrease disease resistance. Genetic modification can be done by different methods including cross breeding, selection, and hybridization (Facts about GMOs). This can take a long time and can require many decades of work. Examples of common foods produced through these ways include nectarines which are genetically modified peaches. Some benefits of this genetic engineering in agriculture include reduced need for pesticides, increased nutrient composition, reduced costs for food or drug production, resistance to pests and disease, as well as some medication production (Phillips 1). In the 1990s, genetic modification techniques moved to a more molecular method that is referred to as transgenic technology. Transgenic technology involves the introduction of an advantageous genetic trait into a plant or animal by the direct transfer of a gene or other method that expresses that trait (Facts about GMOs). The production of corn varieties resistant to some insects, and soybeans resistant to common herbicides are examples of current transgenic technology (Facts about GMOs).
Few realize what the phrase, “GMO free”, on their box from the grocery store actually means. Genetically modified organisms, commonly referred to as GMOs, are typically plants or animals that have been modified in various ways to become a more beneficial or economical organism. “Genetically modified technology has been around for the past twenty years, and today, seventy to eighty percent of the foods we eat in the United States, both at home and away from home, contain ingredients that have been genetically modified.” (Facts about GMOs) GMOs are a huge ...


... middle of paper ...


...ed immunosorbent assay and lateral flow strips (Ahmed 215). New methods of detection include infrared spectrometry. Even with the various testing methods, it is not one hundred percent reliable. Small samples are taken from bushels of the plant and are then tested. It is impossible to test the entire population of plant so those concerned with the amount of GMOs in a product, cannot completely trust the results. Some GMO plants could have gotten into non GMO plants and not been part of the sample that was tested. It should be known that GMOs are extremely common in our foods, especially in the United States. Mircobiologist, Farid Ahmed, says that, “at least sixty percent of food products in US supermarkets contain genetically modified organisms” (215). The stigma associated with these products could ultimately devastate economies and the field of agriculture.

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

Genetic Engineering: The Next Technological Leap or a Disruption to the Natural Order of Our Planet?

- While walking down the produce aisle at your local grocery store, have you ever questioned where the assortment of goods came from. When asked, perhaps your first thought would likely be from a local farm or orchard. But what if I were to tell you that those very goods could in fact be from a far less obvious third choice. What if someone told you that those pretty peaches on display were meticulously grown in a laboratory to bring forth predetermined traits. As futuristic as it may sound, this type of technology is no longer science fiction but has become a new reality....   [tags: Genetic Engineering ]

Strong Essays
936 words (2.7 pages)

Taking a Look at Genetically Modified Organisms Essay examples

- November 6, 2013: “Voters Reject Labels for Genetically Engineered Food in Washington State Today” - The New York Times. June 4, 2013: “Monsanto Sued Over Genetically Modified Wheat” - USA Today. November 4, 2013: “Washington Voters Weigh The Ethics of Genetically Modified Foods” - The Washington Post. If you read the paper or watch the news, you’re undoubtedly aware of the debate raging over genetically modified food. Is it bad or is it good. Between the feuding sides, you might find yourself a little lost and wondering which side is right....   [tags: effects of genetic engineered food production]

Strong Essays
1564 words (4.5 pages)

Genetic Modification : Genetically Modified Organisms Essay

- Genetic modification is made possible due to the common genetic language of all organisms – DNA. Most of the genetic modifications were done based on this mechanism: a gene that codes a desirable trait is extracted from one organism and inserted into another unrelated organism, and if it is done correctly, the new foreign gene can be read and understood by the gene recipient even if these two species are unrelated. The product of such is then called genetically modified organism, also known as transgenic....   [tags: Genetically modified food]

Strong Essays
1236 words (3.5 pages)

Current Negative Social Views On Genetic Modification Essay

- Current negative social views on Genetic Modification (GM) dictate that research of long-term side effects should be encouraged, alongside the encouragement of GM food production. Genetic modification, or the act of artificially altering the DNA of organisms via a method known as gene splicing (Schmidt 2005, A.527), a method in which a section of DNA in a gene is removed and replaced with DNA from another source. Gene splicing in GM improves a food source known to be vulnerable to a specific disease, insect or an environmental concern such as drought; for example, splicing genes into drought-susceptible maize to make it drought-resistant....   [tags: Genetic engineering, Genetically modified food]

Strong Essays
1539 words (4.4 pages)

Genetic Modification : A Controversial Issue Essay

- Final Essay When it comes to the topic of genetic modification, most of us will readily agree that it is a controversial issue. Where this agreement usually ends, however, is on the question of should we continue researching different applications of genetic modification, and allow it to be used on humans. Whereas some are convinced that genetic modification is another step in human development, just like vaccinations, others maintain that it is a slippery slope. I am of two minds, one being that genetic modification could lead to further class separation, sex ratios being off balance, physiological trauma in the modified child, and mistakes being made in the DNA sequence....   [tags: DNA, Genetics, Genetic disorder]

Strong Essays
1892 words (5.4 pages)

Genetic Modification Of Organisms : A Gene Recipient Essay

- Genetic Modification of organisms starts with two organisms, a gene recipient, and a gene donator. The recipient may be an animal, say a cow, however, it can also be a plant, like corn. The donor can be an animal or plant as well. The donor must have a gene sequence that has starting and ending codons exactly the same as the recipient. For example: The donor has a gene that makes the recipient last longer under adverse conditions. The gene sequence is as follows: CAAGGCGCGTATCAGTTCGTCG GTTCCGCGCATAGTCAAGCAGC The bolded letters are the actual gene, which are made of codons....   [tags: DNA, Genetically modified food, Gene, Genetics]

Strong Essays
1447 words (4.1 pages)

Essay about The American Academy Of Environmental Medicine

- The American Academy of Environmental Medicine (AAEM) released a paper in 2009 calling for an immediate ban on genetically modified (GM) foods. Their position paper indicated that “serious health riskrisks associated with GM food consumption includes infertility, immune dysregulation, accelerated aging, dysregulation of genes associated with cholesterol synthesis, insulin regulation, cell signaling, and protein formation, and changes in the liver, kidney, spleen and gastrointestinal system.” There have been various controversies and disputes over the use and consumption of foods developed from genetically modified crops instead of natural crops....   [tags: Genetically modified organism]

Strong Essays
1248 words (3.6 pages)

Ethics of Genetic Modification Technology Essay

- Modern society is on the verge of a biotechnological revolution: the foods we eat no longer serve simply to feed us, but to feed entire nations, to withstand natural disasters, and to deliver preventative vaccination. Much of this technology exists due to the rapid development of genetic modification, and today’s genetically modified crops are only the tip of the proverbial iceberg. Says Robert T. Fraley, chief technology officer for biotech giant Monsanto, “It’s like computers in the 1960s. We are just at the beginning of the explosion of technology we are going to see." Biotechnology’s discontents are numerous and furious, declaring the efforts of corporations of Monsanto to be dangerous...   [tags: Genetic Engineering]

Strong Essays
776 words (2.2 pages)

Cons of Genetic Modification of Plants Essay

- In our everyday lives we have a substantial need for food. Everyone on planet earth needs food to survive from day to day, so engineers have begun mutating plants and crops to create a better source of nutrition to the population. Scientists are pushing the boundaries in order to create the most bountiful crops and, in turn, healthier people. Imagine what could happen if there were larger harvests, more succulent fruits and nutritious vegetables. Our imagination can run wild with the endless possibilities of genetic alteration of food....   [tags: Genetic Engineering ]

Strong Essays
1011 words (2.9 pages)

Essay on Genetic Modification And Genetic Determinism

- In their research article, “Genetic modification and genetic determinism”, David B. Resnik and Daniel B. Vorhaus argue that all the nonconsequentialist arguments against genetic modification are faulty because of the assumption that all the traits are strongly genetically determined, which is not the case. Resnik and Vorhaus dispel four arguments against genetic modification one-by-one. The freedom argument represents three claims: genetic modification prevents the person who has been modified from making free choices related to the modified trait, limits the range of behaviors and life plans, and interferes with the person 's ability to make free choices by increasing parental expectations...   [tags: Genetics, DNA, Determinism, Parent]

Strong Essays
1017 words (2.9 pages)