Genetic Modification : Genetically Modified Organisms Essay

Genetic Modification : Genetically Modified Organisms Essay

Length: 1236 words (3.5 double-spaced pages)

Rating: Better Essays

Open Document

Essay Preview

Genetic modification is made possible due to the common genetic language of all organisms – DNA. Most of the genetic modifications were done based on this mechanism: a gene that codes a desirable trait is extracted from one organism and inserted into another unrelated organism, and if it is done correctly, the new foreign gene can be read and understood by the gene recipient even if these two species are unrelated. The product of such is then called genetically modified organism, also known as transgenic. For example, Golden Rice is created by transferring beta carotene (vitamin A) producing genes from daffodils to rice, for the purpose of solving vitamin A deficiency – a deficiency that kills over 500,000 people every year (Ye 2000). Similarly, in bacteria, genes that encode proteins that are toxic to insects are inserted into crops such as maize, potatoes, and cotton to eliminate the use of pesticides.


Advancements like these sound almost perfect when most first hear about it, but immediately after its development, many questions were soon raised – global citizens, scientists, government and the media began worrying about the potential side effects that genetic modifications could possibly cause on human health and the environment. Since 1990s where transgenic crops were being publicized, consumer advocacy and environmental activists in European countries such as Germany, France, Switzerland, and Britain fought hard against commercialization of transgenic crops, and such anti-GM trend is getting more and more pervasive in the United States in the recent years (Follett 2001). Although the GM technology has made its progress in fields such as agriculture, medical, industrial and environmental applications, critics of GM product...


... middle of paper ...


...e circumstances”, is certainly not justified, not to mention when their motive is not backed by any credible evidence.


By 2050, it is predicted that we will have to produce 70% more food than we do now in order to feed the global population – and this is only one of the challenges that we have to face in the future. The debate on the safety of GM products will undoubtedly remain active for some time. Therefore, perhaps additional testing or even regulation may be the compromise that enables us to continue benefit from GM technology. In the midst of the process, what we as part of the global citizen should do is, like Neil Postman once wrote: “when we admit a new technology to the culture, we must do so with our eyes wide open.” We cannot contain the invasion of huge technological changes; yet we may try our best to embrace or discard whatever components we choose.

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

Genetic Modification Of Organisms : A Gene Recipient Essay

- Genetic Modification of organisms starts with two organisms, a gene recipient, and a gene donator. The recipient may be an animal, say a cow, however, it can also be a plant, like corn. The donor can be an animal or plant as well. The donor must have a gene sequence that has starting and ending codons exactly the same as the recipient. For example: The donor has a gene that makes the recipient last longer under adverse conditions. The gene sequence is as follows: CAAGGCGCGTATCAGTTCGTCG GTTCCGCGCATAGTCAAGCAGC The bolded letters are the actual gene, which are made of codons....   [tags: DNA, Genetically modified food, Gene, Genetics]

Better Essays
1447 words (4.1 pages)

Genetically Modified Organisms And Its Effects On Children Essay

- One morning Jake, a poor third grader living in a small rural town, woke up for school around six in the morning while it was still dark outside. Upon getting out of bed, he found it hard to see, but concluded that it was due to the lights being off. After flipping the light switch, there was no change in his surroundings. Confused, Jake called for his mother, who, when asked about the lights, informed him that they were indeed on. Jake was just one of many children suffering from one serious effect of Vitamin A deficiency, blindness....   [tags: Genetically modified food, Genetic engineering]

Better Essays
2125 words (6.1 pages)

Genetic Modification : Genetically Modified Peaches Essay examples

- Genetic modification of plants has occurred for hundreds of years, as farmers want to improve yields and decrease disease resistance. Genetic modification can be done by different methods including cross breeding, selection, and hybridization (Facts about GMOs). This can take a long time and can require many decades of work. Examples of common foods produced through these ways include nectarines which are genetically modified peaches. Some benefits of this genetic engineering in agriculture include reduced need for pesticides, increased nutrient composition, reduced costs for food or drug production, resistance to pests and disease, as well as some medication production (Phillips 1)....   [tags: Genetically modified organism]

Better Essays
1948 words (5.6 pages)

Genetically Modified Organisms ( Gmo ) ( Gmos ) Essay

- Genetic modification is a process of altering the genetic material of an organism by the use of a method that does not occur in nature. Genetic modification involves isolating, removing and manipulating DNA, and then reinserting the DNA into the same organism or into the genetic material of another organism. Which then leads to the creation of a genetically modified organism (GMO). GMOs can be plants, animals or (most commonly) micro-organisms. The use of GMOs in agriculture is rapidly increasing, since it produces a greater yield in crops than the traditional way of farming....   [tags: DNA, Gene, Genetically modified food]

Better Essays
1178 words (3.4 pages)

Genetic Engineering : Genetically Modified Foods Essays

- A genetically modified organism is a plant, animal, or microorganism whose genetic material has been altered using genetic engineering. Genetic engineering is the process of adding new DNA to an organism, in order to give it new traits it does not naturally grow. DNA from one organism is combined with another organism’s DNA to make one molecule, which then forms a new set of genes. It is then transferred into the organism so it can now have modified genes. Bacteria were the first organisms to be genetically modified in 1973....   [tags: Genetically modified food]

Better Essays
1007 words (2.9 pages)

The Harm of Genetically Modified Organisms Essay

- The Harm of Genetically Modified Organisms Genetic Modification is when the genetic make-up of a living organism is altered (1). This can be done by changing an existing section of DNA or by inserting a new gene (4). Genetic Modification began in the late 1970’s (6). It can be used between different species for example from a plant to a human or an animal to a human. It is often used to enhance the flavour of foods as well as to improve the size and quantity of foods like tomatoes....   [tags: GMOs Genetically Modified Foods]

Better Essays
1017 words (2.9 pages)

The Issue Of Genetically Modified Organisms Essay

- Over time, the human species has applauded themselves for their advances in things like science, technology, medicine, and engineering. However, with every step forward is a step back – many people have become resistant to the changes that the future brings, and many are afraid that these scientific advancements are giving us too much power and ultimately uprooting us from our relationship with nature. This love-hate relationship has most recently been cast upon GMO 's, as there 's been a lot of controversy about whether or not they 're something that we should ban entirely....   [tags: Genetically modified food, Genetic engineering]

Better Essays
1716 words (4.9 pages)

Gmo : Genetically Modified Organisms Essay

- GMO (genetically modified organisms) What is is a GMO. A GMO is a genetically modified organism. GMO’s are good so we should modify more organisms because they are helpful and we will need them in the future. Also genetically modified organisms have a lot of benefits to the like making more with less or getting bigger food also these benefits are not just for plants but for for people bugs insects and all living organisms. But There are Also a lot of concerns for genetically modified organisms because we are making the food in a lab and not naturally growing it and also that it can cause cancer or that it can produce super weeds and many more....   [tags: Genetically modified organism]

Better Essays
1375 words (3.9 pages)

Essay on Benefits Of Genetically Modified Organisms

- Humans have used breeding techniques or artificial selection, which is the intentional reproduction of desirable traits that humans decided to spread onto offspring, to enhance and alter genetically organisms. However, the form of genetic enrichment that produces the most concern goes a step beyond selective breeding. With the advances in biotechnology, humans have developed the exchange of genes between organisms to display specific traits, such as a resistance to pesticides and herbicides. Genetic exchange is basically a sophisticated form of a cut-and-paste operation....   [tags: Genetically modified organism]

Better Essays
1739 words (5 pages)

Genetic Modification of Food Essay

- ... GM crops may be less susceptible to insect related diseases or viruses and may tolerate herbicides better. A gene originating in bacterium Bacillus thuringiensis (Bt) produces a toxin. It can be introduced into plants to make them more insect-resistant. Introducing genes from disease-causing viruses into the plants enables them to develop a resistance to the viruses. Some bacteria have specific genes, which make them resistant to herbicides. Consequently, introducing this gene into plants makes them more resistance to some herbicides....   [tags: genetic engineering, GMOs, biotechnolgy]

Better Essays
3180 words (9.1 pages)