Exonuclease : The Natural Gene Corrector Essay

Exonuclease : The Natural Gene Corrector Essay

Length: 1121 words (3.2 double-spaced pages)

Rating: Strong Essays

Open Document

Essay Preview

Exonuclease: The Natural Gene Corrector
Hallie Shannon
Dr. Jacqueline Jones
April 15, 2016

Exonuclease: The Natural Gene Corrector
Deoxyribose nucleic acid, more commonly known as DNA, contains the genetic material that connects all living organisms. It is responsible for height, eye color, skin color, and many other traits. DNA is comprised of nucleotides, which contains a nitrogenous base, a pentose sugar, and a phosphate group. There are four nitrogenous bases: adenine, guanine, thymine, and cytosine. These bases are sectioned into two groups, pyrimidines and purines. One pyrimidine binds with one purine; adenine binds with thymine and guanine binds with cytosine. When millions of these bases bind together, DNA in its double helical structure is formed. When DNA is replicated, the two sides are separated by helicase and DNA polymerase, an enzyme, allows for complementary bases to from on the separated strands ("What is DNA? - Genetics Home Reference," 2016). When bases attach, there is a chance that a mutation will occur.
There are many different mutations that can occur including silent mutations, insertions, deletions, frameshift mutations, and nonsense mutations. A silent mutation is a change in a single base that is undetectable. An insertion is the addition of a base and deletion is the removal of a base. A frameshift mutation is a deletion of a single base that causes a shift in the reading frame, which is read in triplet code. The last common mutation is a nonsense mutation where a base is changed to code for a stop codon ("Types of mutations," 2016). When these mutations occur, they can be corrected through proofreading the strand.
Proofreading of DNA is done by exonuclease. According to an article in...


... middle of paper ...


...1093/hmg/ddt131
Fazlieva, R., Spittle, C. S., Morrissey, D., Hayashi, H., Yan, H., & Matsumoto, Y. (2009). Proofreading exonuclease activity of human DNA polymerase and its effects on lesion-bypass DNA synthesis. Nucleic Acids Research, 37(9), 2854-2866. Retrieved from http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2685094/
Proofreading Function of DNA Polymerase [Video file]. (n.d.). Retrieved from https://www.youtube.com/watch?v=42boKYMontE
Types of mutations. (2016). Retrieved from http://evolution.berkeley.edu/evolibrary/article/mutations_03
Wang, D., & Hawley, D. K. (1993). Identification of a 3 '-->5 ' exonuclease activity associated with human RNA polymerase II. Proceedings of the National Academy of Sciences,90(3), 843-847. doi:10.1073/pnas.90.3.843
What is DNA? - Genetics Home Reference. (2016, April 12). Retrieved from https://ghr.nlm.nih.gov/primer/basics/dna

Need Writing Help?

Get feedback on grammar, clarity, concision and logic instantly.

Check your paper »

Evolution Of Evolution And Natural Selection Essay

- Evolution can be defined as the process through which the characteristics of a species undergo changes over a number of generations through the process of natural selection. There are different mechanisms that try to explain the evolution process and these are mutation, migration, genetic drift and natural selection. However for natural selection and genetic drift to take place there must exist a certain type of genetic variation. To begin with natural selection can be defined as the process through which organisms that are better adapted to a certain environment survive and produce fertile off springs....   [tags: Evolution, Biology, Natural selection, Gene]

Strong Essays
920 words (2.6 pages)

Charles Darwin 's Theory Of Natural Selection Essay

- There must be very few people from biology or evolutionary background who are not aware of the work of Charles Darwin. Charles Darwin proposed that evolution occurs through the process of natural selection. Natural selection is the process by which species adapt to their environment in order to survive. Species evolve from one to the next through random genetic mutation, if the said mutation is beneficial then it is preserved and is passed down to the next generation to help with the survival of that species....   [tags: Evolution, Natural selection, Gene]

Strong Essays
733 words (2.1 pages)

Essay about Causes And Effect Of A Gene Mutation

- There are many ways in which a gene mutation can leave a protein unaffected. This is due to silent mutations. Other mutations, missense, sense, or nonsense mutations have a more dramatic affect. One result of a missense mutation is sickle-cell anemia in which a hydrophilic amino acid is exchanged for a hydrophobic one. This causes the proteins to come together and create sickle-shaped blood cells. Polycythemia is a result of a nonsense mutation; a hemoglobin protein is shortened and results in thickened blood....   [tags: DNA, Mutation, Point mutation, Gene]

Strong Essays
1466 words (4.2 pages)

Essay on Natural Selection That Causes Evolution

- Genetic drift decreases genetic variation in a population. It is very important mechanism in addition to natural selection that causes evolution. The process of evolution has been explained through various evolutionary methods in particular molecular phylogenies. Scientists have become very interested in learning about other mechanism beside natural selection that can explain evolution. Natural selection is very important to mechanism that helps explain factors such as morphology, behavior that are related to phenotype which can affect reproduction and survival of an animal....   [tags: Gene, DNA, Evolution, Natural selection]

Strong Essays
718 words (2.1 pages)

Essay on Genetic Disorders And Gene Therapy

- There are thousands of children born with genetic disorders each year in every part of the world, but unfortunately none of them can be cured, yet. A genetic disorder is a disease that an individual is born with where there is a deformity in his or her DNA. However, with future advancements in medicine, there is a chance that doctors and scientists may be able to detect these gene abnormalities before a child is conceived. What this entails is scanning an egg and/or the sperm of two possible parents and then altering their genetic make-up to eradicate the potential abnormality, or as it is called today, germline gene therapy....   [tags: Genetics, DNA, Gene, Genetic disorder]

Strong Essays
2022 words (5.8 pages)

Gene Thearapy: The Usage of Gene as Medicine Essay

- Introduction The usage of genes as medicine give rise to the concept of 'Gene Therapy'. In the process of Gene therapy, a defective gene copy is repaired by transmitting therapeutic gene copy into those cells of an individual. So thereby, a faulty gene could be replaced or a medical condition may be corrected by introducing a new gene. Gene therapy has a promising future as it is powerful enough to treat many genetic conditions and also other deathly disease like AIDS, cancer etc. Though the potential of "gene therapy" is realized and recognized, it remains still on an experimental level and needs to worked on before accepting as the best solution....   [tags: ethical considerations, gene transfer]

Strong Essays
1065 words (3 pages)

Genetic Modification Of Organisms : A Gene Recipient Essay

- Genetic Modification of organisms starts with two organisms, a gene recipient, and a gene donator. The recipient may be an animal, say a cow, however, it can also be a plant, like corn. The donor can be an animal or plant as well. The donor must have a gene sequence that has starting and ending codons exactly the same as the recipient. For example: The donor has a gene that makes the recipient last longer under adverse conditions. The gene sequence is as follows: CAAGGCGCGTATCAGTTCGTCG GTTCCGCGCATAGTCAAGCAGC The bolded letters are the actual gene, which are made of codons....   [tags: DNA, Genetically modified food, Gene, Genetics]

Strong Essays
1447 words (4.1 pages)

Essay about Gene Drive And Its Effects On Human Life

- Introduction Gene drives are a controversial new invention designed to mutate genes of an organisms that contain harmful and invasive diseases. A gene drive is a unique tool that enables scientists to edit sections of the genome by cutting or relacing segments of DNA. It causes a dominant mutation to a gene, changing its function and is passed down to all offspring. It is designed in order to eliminate mosquito transmitted diseases, such as malaria and Zika virus, but also to control species invasion....   [tags: DNA, Mutation, Gene, Genetics]

Strong Essays
1169 words (3.3 pages)

Different Types Of Natural Selection Essay

- When looking through the notebook trying to find the subjects that I wanted to talk about I found two topics that I thought were the most interesting and that I understood the most. The first chapter that I thought was the most interesting to me was natural selection. I think it’s really interesting because it is so prevalent in our lives. There are two different parts of natural selection. There is natural selection itself and then there is also non-adaptive evolution. Natural selection deals with the change of allele frequencies because of the change in the environment....   [tags: Evolution, Genetics, Gene, Allele]

Strong Essays
821 words (2.3 pages)

Mechanism of Transfer in Gene Therapy Essay examples

- Mechanism of Transfer in Gene Therapy Abstract: Gene therapy is the transfer of “normal” genes into the body to replace defective or undesired genes. The transfer may be in somatic or germline cells and may take place in vivo or in vitro. The DNA may be inserted in a retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, or liposome, or it may be naked DNA. The vector travels to a target cell and inserts the gene, which goes to the host cell’s nucleus and may integrate into the genome....   [tags: Gene Therapy]

Strong Essays
2072 words (5.9 pages)