The Zebra Fish and Human Diseases

1477 Words6 Pages
1.0 Introduction
1.1 Zebra Fish
The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8).
1.2 Polymerase Chain Reaction (PCR) and RT-PCR
Polymerase Chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated it is able to be copied as much as needed (2). In this experiment PCR was used to isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows:
5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’
5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’
Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2).
Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe expression levels of RNA (10). Using RT-PCR one is capable of identifying a predetermined gene (vangl2) via complementary Deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcribing its cDNA through the enzyme reverse transcriptase (10).
1.3 Gel Electrophoresis.
F...

... middle of paper ...

...udhry B., Copp A.J., Henderson D.J. (2005) “Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract, n.d. Web. 11 March 2014

6. Borovina, Superina, Voskas, Cirunia. (2010) “Vangl2 directs the posterior tilting and asymmetric localization of motile primary cilia, n.d. Web. 15 March 2014

7. Ingham P. (2009) “The power of the zebrafish for disease analysis, n.d. Web. 15 March 2014

8.Wen Z. (2013) “The zebrafish model: use in studying cellular mechanisms for a spectrum of clinical disease entities, n.d. Web. 15 March 2014
9.Bustin SA, Benes V, Nolan T, Pfaffl MW (June 2005). "Quantitative real-time RT-PCR-- a perspective". J. Mol. Endocrinol. Mon. 21 April 2014
10. Bustin SA (October 2000). "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays". J.
Open Document