The Zebra Fish and Human Diseases

1477 Words3 Pages
bulb-icon

Recommended: case study on gel electrophoresis

1.0 Introduction
1.1 Zebra Fish
The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8).
1.2 Polymerase Chain Reaction (PCR) and RT-PCR
Polymerase Chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated it is able to be copied as much as needed (2). In this experiment PCR was used to isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows:
5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’
5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’
Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2).
Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe expression levels of RNA (10). Using RT-PCR one is capable of identifying a predetermined gene (vangl2) via complementary Deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcribing its cDNA through the enzyme reverse transcriptase (10).
1.3 Gel Electrophoresis.
F...

... middle of paper ...

...udhry B., Copp A.J., Henderson D.J. (2005) “Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract, n.d. Web. 11 March 2014

6. Borovina, Superina, Voskas, Cirunia. (2010) “Vangl2 directs the posterior tilting and asymmetric localization of motile primary cilia, n.d. Web. 15 March 2014

7. Ingham P. (2009) “The power of the zebrafish for disease analysis, n.d. Web. 15 March 2014

8.Wen Z. (2013) “The zebrafish model: use in studying cellular mechanisms for a spectrum of clinical disease entities, n.d. Web. 15 March 2014
9.Bustin SA, Benes V, Nolan T, Pfaffl MW (June 2005). "Quantitative real-time RT-PCR-- a perspective". J. Mol. Endocrinol. Mon. 21 April 2014
10. Bustin SA (October 2000). "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays". J.

Show More
Related

  • Overview Of The Zebra Mussel

    1121 Words  | 3 Pages

    It’s important that Zebra Mussels are dealt with great care. Zebra Mussels get their food and energy from filtering water. Nearly a quart can be filtered by and adult Zebra Mussel (“Zebra Mussels,” 2013, para. 5). So if there was an infestation of Zebra Mussels in a lake they could filter a lo...

    Read More

  • Ligation And Check The Success Of The Ligations

    1572 Words  | 4 Pages

    ...It allowed access to virtually annotate sequences freely, build and visualize maps, design primers, and restriction analysis. First, the pEGFP-N1 plasmid nucleotide sequence was found by using the NCBI nucleotide database program. SnapGene viewer illustrated the restriction enzyme cut sites used to cut EGFP gene from the pEGFP-N1 source plasmid. Then the pET-41a (+) vector sequence was found by using the AddGene Vector Database. A new DNA file representing the recombinant pET-41a (+)-EGFP plasmid was built by virtually cloning the EGFP gene insert into the pET-41a (+) vector sequence. The plasmid was virtually cut utilizing the pAD1 sense primer and pAD1 anti primer from the PCR procedure. A restriction digest experiment was designed to confirm the identity of the PCR product. The two restriction endonucleases that cut the PCR product at least once was HgaI and XspI.

    Read More

  • Drosophila Ausomal and Sex-Linked Cross

    1383 Words  | 3 Pages

    Cain, M. L., Urry, L. A., & Reece, J. B. (2010). Campbell Biology. Benjamin Cummings.

    Read More

  • Zebrafish Benefits

    1986 Words  | 4 Pages

    The development of the heart is a complicated process that implicates cell specification and differentiation, including tissue formation, shaping and alteration, to create a functional organ. The zebrafish has become a potential model system to disentangle the fundamental genetic, molecular, and cellular mechanisms of cardiac development and function. The liver is one of the essential organ in mammals. It performs many functions such as help the body digest food, store energy, and remove poisons. The liver also completes many regulatory functions that are critical to fetal development and to life in general. However, failure to perform theses function can result in many mammal liver diseases. Hepatomegaly is a symptom that associate with several liver disorders. Surveys had shown that a large number of the death in the US is caused by chronic liver disease. Liver cancer is another type of liver diseases that is one of the main cause of cancer-related death worldwide.

    Read More

  • Silver’s Remaking Eden and the Silver Screen

    1206 Words  | 3 Pages

    limitations” with his invention of the Polymerase Chain Reaction or “PCR” (240). As Silver describes

    Read More

  • How Does the Embryo Take Form and Differentiate to Become an Organised Organism?”

    1233 Words  | 3 Pages

    ...s formation, and hopefully from that gain further understanding of other early embryological processes. These discoveries have also led to an understanding of how axis formation can go wrong, and how to best approach it from a clinical perspective. The current knowledge has raised a lot of questions in regard to the cilia found in the node. How do the cilia know to turn clockwise to beat? Can that be changed to anti-clockwise somehow? What determines their posterior lean? Do all species create a left ward flow in the same way seen in mice? Do they also use cilia, or is there other methods employed by different species? There is still more to be discovered about left-right axis formation, and with the current knowledge and advances in technology, it is hoped that the gaps in the current knowledge are filled to allow for advances in other embryological processes.

    Read More

  • Sequencing Is An Example Of Next Generation Sequencing Method

    966 Words  | 2 Pages

    Illumina sequencing is an example of next-generation sequencing method. It uses fluorescence-based sequence-monitoring technology and contributes to about 90% of current sequencing data2. In Illumina platform, vast numbers of short reads are sequenced in a single stroke. To do this, the input sample must be cleaved into short sections firstly and the length of these sections will depend on the particular Illumina sequencing machine used. In Illumina sequencing, 100-150bp reads are used, somewhat longer fragments are ligated to generic adaptors and annealed to a slide using the adaptors. PCR is then carried out to amplify each read, creating a spot with many copies of the same read. They are then separated into single strands for sequencing3.

    Read More

  • Christiane Nusslein-Volhard Research Paper

    264 Words  | 1 Pages

    In the year 1992, she started her research on the developmental genes in the Zebrafish. This is an important fact because without

    Read More

  • Zebrafish Research Paper

    584 Words  | 2 Pages

    Laboratory reared wild-type (Tropical 5D) D. rerio were maintained in a recirculating AHAB system (Aquatic Habitats, Inc., Apopka, FL, USA) on a 14:10 h light/dark cycle. Water quality was maintained at 28-29°C, pH 7.0-7.5, and 60 ppm artificial seawater (ASW; Instant Ocean, Foster & Smith, Rhinelander, WI, USA). Adult fish were fed twice daily ad libitum with Artemia nauplii in the morning and Zeigler’s Adult Zebrafish Complete Diet (Zeigler Bros., Inc., Gardners, PA, USA) in the afternoon.

    Read More

  • Sequencing Synthesis Lab Report

    640 Words  | 2 Pages

    The first thing to be done to accomplish the sequencing through this method is preparing the DNA library for the desired genome. The DNA library is prepared under three phases, the first phase is cutting the genomic DNA into small pieces. This is done by physical shearing of the desired DNA molecule or by restricting it either using certain enzymes. The shearing of the DNA is only done if its pieces or fragments are very long. The adaptors, primers and barcodes are introduced to all the clones in our DNA library, reason being that there are no vectors in next generation DNA library. The adapters are used to bind cloned fragments onto the beads and the primers are essential for the sequencing of the clone by polymerase. The barcodes are used for amplicon sequencing. The last step under DNA library preparation is the size selection, only fragments of assured size are sequenced. Now the DNA can be sequenced using methods such as the Emulsion PCR and the Polony

    Read More

  • Starfish Essay

    1469 Words  | 3 Pages

    Wilkie, I.C. "Autotomy as a Prelude to Regeneration in Echinoderms." Microscopy Research and Technique 55.6 (2001): 369-96. Print.

    Read More

  • The Zebrafish Diets

    2118 Words  | 5 Pages

    However, very little is known about zebrafish biology, including their dietary requirements in wild environments. Diet is a critical factor in controlling health to maintain the population of zebrafish in research and to produce constant results from each individual. Diet can also be a critical contributor to changing physical composition as different diets affect animals differently in terms of body weight and length or height gain. Consequently, if future research uses different diets for the same species of animals, the result may contain unwanted nutritive bias and not account for otherwise controllable variability in these features (Spence, et al. 2007). This paper will review zebrafish diet, specifically covering natural diet, aspects of commercial and formulated diets, and physiological influence of diets

    Read More

  • Essay On Hematopoiesis

    641 Words  | 2 Pages

    ...n the genome furthermore narrowing the critical interval containing the mutation using RFLP markers and SNP analysis. Based on the knowledge about phenotype of syrah, microinjection of syr in Med12 mRNA knockdown WT mice were studied and rescued to understand the underlying genomic causes of the phenotypical effects of syr mutant zebrafish. Gene expression analysis using whole mount in situ hybridization (WISH) helped in the assessment of hematopoietic development by identifying specific mRNA species within individual cells in tissue sections, providing insights into physiological processes and disease pathogenesis. Tail snip assay of embryonic zebrafish was transected at 49 hours post fertilization to determine the residual neutrophil migration pattern in syr mutant compared to wild type mice. Many of these methods used were to further support the research finding.

    Read More

  • The Generation Sequencing ( Ngs ) Technologies

    1330 Words  | 3 Pages

    RNA-Seq is technique that allows to quantify gene expession patterns for RNA profiling dependent on NGS (4). Before RNA-Seq methodology has been used, scientists were using Microarray technique for gene expression study (4). RNA sequencing framework enables to examine the presence of all RNAs in a study sample, differentiating their sequences as well as determing their abundances simultaneously. RNA-Seq method takes place to any of many various techniques of NGS applied for gaining whole transcriptome profiles of RNA that can be explored in cell, tissue and other multicellular organisms (5). In addition, all of NGS technologies can be applied for RNA sequencing method. Each of these technologies or aggregation of them have been used as distict RNA-Seq technologies. Despite they share the same concept to produce RNA seq...

    Read More

  • Argumentative Essay On Transgenic Animals

    938 Words  | 2 Pages

    GloFish are fluorescently labeled zebrafish. These fish are different colors and fluoresce under UV light. Critics have declared that this is an abuse of our knowledge and understanding of transgenic animals. However researches have discovered that when the fish are placed in a contaminated tank with “heavy metal” the GloFish fluoresce. (Klug, 399) These fish have proven to be a bioassay that can determine if a tank is contaminated. Their genetically modified phenotype is an easy to see test result which determines how contaminated the water

    Read More

More about The Zebra Fish and Human Diseases

Open Document