Procedure for Isolating Genomic DNA

List of Tables
Table2.1. Agarose gel (1%)
Table 2.2. (TBE)Tris borate EDTA buffer (10X)
Table 2.3. TBE(1X)
Table 2.4. Gel Loading dye (6X)
Table 2.5. Ethidium Bromide Solution
Table 2.6. Allele specific PCR primers
Table 2.7. PCR reaction mixture and cycling conditions
Table 2.8. PCR reaction mixture
Table 2.9. SNP’s PCR(total reaction volume 50µl)
Chapter 2:Materials and Methods
Materials
Table2.1. Agarose gel (1%)
Serial no. Ingredient Amount(g/L)
1 Agarose gel 1
2 TBE buffer (1X) 100ml

Table 2.2. (TBE)Tris borate EDTA buffer (10X)
Serial no Ingredient Amount(g/L)
1 Tris base 54
2 Boric acid 27.5
3 0.5M EDTA 20ml
4 dH2O Upto 500ml

Table 2.3. TBE(1X)
Serial no Ingredient Amount(ml/L)
1 10X TBE 100
2 dH2O 900ml

Table 2.4. Gel Loading dye (6X)
Serial no Ingredient Amount
1 Bromo phenol Blue 0.025g
2 Xylene Cyanol 0.025g
3 Glycerol 3ml
4 dH2O 7ml
Total 10ml

Table 2.5. Ethidium Bromide Solution
Serial no Ingredient Amount
1 Ethidium Bromide 10mg
2 dH2O 1ml

Table 2.6. Allele specific PCR primers
і)rs9818870
Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product
1 F1.3 5'--- GCT GCTTGGTGCCTCTCTGATAC---3' C/T 61.5 61.2 667bp
2 F2.3 5'--- GCTGCTTGGTGCCTCTCTGATAT ---3'
C/T 60.4 61.2 667bp
3 R3 5'--- CGAGGTAGGAACACAGCACA ---3'
C/T 58.2 61.2 667bp ii)rs2258287 Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product
1 F1.11 5'--- CGTCATGAAGGAGGCTTGATAACG ---3' G/T 58.8 578bp
2 F2.11 5'--- CGTCATGAAGGAGGCTTGATAACT ---3' G/T 57.6 59.4 578bp
3 R11 5'--- ACTGCTCTTGGCAACAACCT---3'
G/T 58.2 578bp

Table 2.7. PCR reaction mixture and cycling conditions
і) .Gradient PCR
Serial no. Chemicals Stock Conc. Wor...

... middle of paper ...

... that it may not damage the casting tray. The gel was poured into a gel casting tray and the comb was inserted.The gel was allowed to solidify for about half an hour. The comb was removed and the tray was placed into the gel apparatus. The sample was prepared by mixing DNA sample with the loading dye in 3:1 ratio (e.g.3 µl of DNA sample was mixed with 1 µl of loading dye). The samples were loaded into the wells carefully by releasing the sample at the bottom of the well but vigilantly not to tear off the well. Power was set at 100 or 80V for Genomic DNA and PCR products respectively and the gel was run until the dye reaches two third of the gel. The power supply was turned off and the gel was placed into a staining solution for 15 minutes (5µl of ethidium bromide per 100ml water).The gel was observed under UV light to see the location and intensity of the DNA bands.