Search Results

Free Essays
Good Essays
Better Essays
Stronger Essays
Powerful Essays
Term Papers
Research Papers

Your search returned over 400 essays for "primer"
1  2  3  4  5    Next >>

These results are sorted by most relevant first (ranked search). You may also sort these by color rating or essay length.

Title Length Color Rating  
A Neural Network Primer - A Neural Network Primer This paper gives the basics of the subject of neural networks. It is recommended for those new to the subject of neural networks and only assumes that the reader has a knowledge of basic algebra. Please feel free to distribute this paper as you wish but please distribute the entire paper without deletions and limit your corrections and additions to the space below the bottom line after the last paragraph of the original text. If you wish for your correction or modification to be changed in the body of the original text, please send your recommendation to one of my computer addresses above....   [tags: Neural Network Primer Essays] 4852 words
(13.9 pages)
Strong Essays [preview]
A Review of the Film Primer by Shane Carruth - A Review of the Film Primer by Shane Carruth This week I’m reviewing a film that was not hugely publicized, Primer. I’ll be telling you whether it’s a must see cult film to be or whether the film wasn’t publicized for a good reason. Basic run down of the story is that a group of amateur inventors who want to create something more than the simple low profit creations they have come up with so far. They create a machine which slows down or speeds up time of the space inside it. After discovering this ‘device’ the group uses this to travel, a few hours at a go, through time....   [tags: Papers] 489 words
(1.4 pages)
Strong Essays [preview]
Rules for Radicals: A Practical Primer for Realistic Radicals, by Saul Alinsky - “That citizen sinks further into apathy, anonymity, and depersonalization. The result is that he comes to depend on public authority and a state of civic-sclerosis sets in” (Alinsky, 1971). This statement perfectly describes what is happening to the people today. People are no longer concerned with what is happening around them. The world today is living in an individualization phase where there are more people who know more stuff about the celebrities, latest fashion and gadgets, rich lifestyle, etc....   [tags: Rules for Radicals]
:: 2 Works Cited
1941 words
(5.5 pages)
Better Essays [preview]
Theories in Frederickson’s book,: The Public Administration Theory Primer - As explained in Frederickson’s book, “The Public Administration Theory Primer” there is so many types of organizational theory in public administration. We are going to explore only three of these theories and their applications to public and non-profit administrations in the 21st century. The first theory we are going to analyze is the theories of Political Control of Bureaucracy. This theory focuses on the question of bureaucracy compliance with the law and the preferences of the lawmakers. There is much distrust of American philosophy in the power of government in public administration....   [tags: Institution, Structure] 1953 words
(5.6 pages)
Powerful Essays [preview]
Teaching Young Children the Alphabet - ... Each letter has an attached story or a saying. The pictures are in black and white, they go along with the passage attached to the letter. For example, the letter A has a passage saying “In ADAM’s Fall We finned all” next to the passage is a picture of Eve handing Adam an apple while standing next to a apple tree with a snake wrapped around the tree. Fundamental tensions about the fatherhood of God are presented which as a child grows may interpret as their conflict with parental authority (Watters, 1985)....   [tags: New-England Primer, ABC by Dr. Seuss] 1276 words
(3.6 pages)
Better Essays [preview]
The Development of Primers for Unknown Thermophilic Bacteria at Vulcan Hot Springs - The Thermus Aquaticus project’s purpose is to identify a species of thermophilic bacteria found in a local hot spring, Vulcan Hot Springs, through genetic sequencing and analysis. The polymerase gene in other Thermus bacterias has proven useful in genetic reactions. The Vulcan bacteria grows at a higher temperature than other thermophilic bacterias, giving it the potential to have a more effective polymerase gene than what is currently available. My own research has been focused on designing effective primers for the polymerase gene in the bacteria....   [tags: Genetics]
:: 4 Works Cited
1740 words
(5 pages)
Powerful Essays [preview]
Primed Social Roles on Gender Differences in Conformity - Conformity is defined as “a change in one’s behavior due to he real or imagined influence of other people.” Research has shown that impersonating a certain group or persons ideas, or conforming to their beliefs, happens so quickly and without thought that it’s mechanical and the reason that conformity is constantly present because it is habitual (Griskevicius, 2006). While assessing a situation we are uncertain about, we can find more precise information by adhering to others, eventually leading to correct decision-making....   [tags: sex differences in human behavior]
:: 6 Works Cited
1293 words
(3.7 pages)
Strong Essays [preview]
The Persistence of the Legend of a Diety - ... There are quite a few ways that people may be primed to believe in god(s). One of these ways is that they may have been raised by parents who believed the legend and would have taught them to believe as well. By having these beliefs programmed into them, these people could be more likely to accept the legend of god(s) as fact. Human beings also tend to have an insatiable urge to understand and explain things that occur around them and the unanswerable questions of life. Some of the biggest questions are answered by the existence of god(s), such as how life came to be, what the purpose of life is, and what morals are the right ones....   [tags: community, primed, belief] 1101 words
(3.1 pages)
Better Essays [preview]
The Roman Soldier: Primed for Battle - To climb the social ladder a person must be, in one way or another, more powerful than whom they are passing in life. As this is true for an individual, it is also true for an assemblage of individuals. Whether it is a village, city, or country, to survive you must be stronger than your challengers to defeat them. On the largest scale you would need an army to accomplish this feat. For centuries the Roman Empire was the most powerful civilization in the world and this was due to the invincibility of its military forces and prowess of its soldiers....   [tags: Roman History ]
:: 3 Works Cited
1221 words
(3.5 pages)
Strong Essays [preview]
America's Productivity Pump is Primed - Recently, my other business had occasion to hire a new part-time person. This is usually a difficult experience given that the labor pool in our resort town is (a) limited and (b) largely populated by people who'll abandon their duties for a good powder day on the ski hill. (Note, I'm not that much of a curmudgeon, but things DO have to get done!) Anyway, it was with a sense of trepidation that I posted the position on a local online classified ad web site. The results were unexpected, exhilarating and heart-breaking all at once....   [tags: Personal Experience] 1225 words
(3.5 pages)
Strong Essays [preview]
Brain Turmors: Meningioma - ... Meningiomas may recur, either as a slow-growing tumor or as a more rapidly growing tumor (Brain Tumor Primer 50). Recurrent tumors are treated similarly with surgery followed by radiation therapy or radiosurgery (Brain Tumor Primer 50). Chemotherapy is being studied for recurrent meningioma (Brain Tumor Primer 51). Glioma is a common type of brain tumor. Glioma arises from three different types of cell: astrocytes, oligodendrocytes, and ependymal cells (“Yamanaka” 2). Astrocytes are the connective tissue cells and oligodendrocytes are the supportive cells of the brain (Brain Tumor Primer 33)....   [tags: patients, glioma] 1266 words
(3.6 pages)
Strong Essays [preview]
When Art Imitates Life: A Research and Analysis on the Creative Work of Gwendolyn Brooks - There have been many authors, poets, writers and artists that shaped the face of Culture. It is safe to say that even in this concept; many writers have subconsciously assumed the responsibility of making sure this theory is reflected in their work. This notion has also established a foundation designed to foster analytical ideals as well as expand the knowledge and definition of culture itself. This idea also gives the perception that validates the importance of writers and the need for their work to be studied....   [tags: creative writing, evolution of racism]
:: 4 Works Cited
1190 words
(3.4 pages)
Strong Essays [preview]
The Catalytic Subunit: B-family of Replicative DNA Polymerases - ... Most of our structural knowledge of the B-family of DNA polymerases came from the structure of the prototypical family member, bacteriophage RB69 Pol (Wang et al., 1997 in elife). Followed that the structure of the bacterial DNA Pol II (Wang and Yang, 2009 in elife) and then yeast Pol δ (Swan et al., 2009). Only recently, the crystal structure of the catalytic domain of the yeast Pol α subunit, Pol α 349–1258, has been solved (elife). The structure confirmed that Pol α shares a polymerase and an exonuclease domains similar to RB69 Pol, bacterial DNA Pol II and yeast Pol δ....   [tags: polymerase a, mammalian] 587 words
(1.7 pages)
Research Papers [preview]
The Influence of Christianity on Education - Society has been shaped by the principles and traditions set forth by its predecessors. In the early 1600’s, citizens from Europe immigrated to the New World for religious freedom and a new life. The New World was a vast unexplored land filled with immense opportunities unseen by the settlers of that time. Communities, colonies, and small sized governments, formed all throughout the region and societal issues began to arise. With the different issues that arose, settlers realized the importance and necessity of some type of education system....   [tags: Religion]
:: 1 Works Cited
2247 words
(6.4 pages)
Term Papers [preview]
Procedure for Isolating Genomic DNA - ... Allele specific PCR primers і)rs9818870 Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product 1 F1.3 5'--- GCT GCTTGGTGCCTCTCTGATAC---3' C/T 61.5 61.2 667bp 2 F2.3 5'--- GCTGCTTGGTGCCTCTCTGATAT ---3' C/T 60.4 61.2 667bp 3 R3 5'--- CGAGGTAGGAACACAGCACA ---3' C/T 58.2 61.2 667bp ii)rs2258287 Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product 1 F1.11 5'--- CGTCATGAAGGAGGCTTGATAACG ---3' G/T 58.8 578bp 2 F2.11 5'--- CGTCATGAAGGAGGCTTGATAACT ---3' G/T 57.6 59.4 578bp 3 R11 5'--- ACTGCTCTTGGCAACAACCT---3' G/T 58.2 578bp Table 2.7....   [tags: blood, gel, ethanol] 1239 words
(3.5 pages)
Strong Essays [preview]
The Large Regulatory Subunit - ... 2010 ). To date, the structure of PriL has not been solved in its integrity. Instead, substructures of a C-terminally truncated version of PriL (PriL-ΔCTD) have been solved in archaea and human (….). In addition, the structure of PriL-CTD has been reported for both yeast and human. In fact, two crystal structures were reported for the human p58C (C terminal domain of the human large subunit) (…..). In both archaeal and eukaryotic primases, PriL-CTD exhibits a similar structure consisting of two main domains; PriLα and PriL-SBD....   [tags: primase, non-catalytic subunit] 589 words
(1.7 pages)
Research Papers [preview]
How Antiboiotics Have Influence Modern Day Society? - ... According to The Journal of Medical microbiology (A.P Johnson and n. Foodford:2011:398), antibiotics minimise the duration of illness by 50%. Thus antibiotics have promoted a productive working environment as patients feel better sooner and return to work. It not only rids us of life threatening bacterial infection, it also has many functions and abilities. It has anti-inflammatory properties and can be used for a widespread of health problems from a urinary tract infection to acne prevention....   [tags: primery health discovery, immune system] 639 words
(1.8 pages)
Research Papers [preview]
The Insertion of L. hesperus TuSp1 gene into B. mori - Figure 1. TuSp1 molecular structure (Solution structures of TuSp1 domains). The amino acid sequence of the TuSp1 gene contains a signal peptide at the N terminus that is adjacent to the NTD non repetitive sequence. There is also a non repetitive sequence at the C terminus (CTD). Linked to the CTD there is a RP2 type two repetitive sequence. Also present are 20 identical type 1 repetitive sequences ( RP1). Pictures A-H represent the different TuSp1 gene domains. Pictures A-D represent NTD, RP1, RP2 and CTD domains respectively....   [tags: L. hesperus TuSp1 gene]
:: 19 Works Cited
2726 words
(7.8 pages)
Research Papers [preview]
Structures and Roles of Telomeres - Structures and Roles of Telomeres Telomeres are essential structures in eukaryotic cells. Through repeat nucleotide sequencing of TTAGGG and their six associated protein complexes, they provide a “cap” over the rest of the chromosome, which protects the genetic material contained within the chromosome from instability1. Without the telomere structures, chromosomes are prone to tearing due to the action of nucleases and other damaging components within the nucleus. Torn chromosomes prove to be unstable, often fusing end-to-end or rearranging....   [tags: catallyst, cells, chromosome, telomerase, DNA]
:: 10 Works Cited
881 words
(2.5 pages)
Better Essays [preview]
Restoring a Vehicle - If you are thinking of restoring a vehicle there are many things to remember before you start. First, it won't be cheap by any means, nor will it be fast. It will take lots of work and you should be prepared for the long haul. Also there is many hidden surprises along the way, but at the end it is worth every hour and dollar invested in it. To restore a vehicle, one must understand how to remove, refinish, repair, and replace both interior and exterior parts (Classic Car Restoration for Dummies.) On some vehicles it maybe better to remove the body of the vehicle from the frame....   [tags: Classic Car Restoration, Cars Parts, Manua Labor]
:: 10 Works Cited
1294 words
(3.7 pages)
Strong Essays [preview]
Investigation Methods of Firearms - ... In order leave such an impressed mark the contact has to be made with sufficient pressure or force. Striation marks on cartridge cases are mainly formed when they go through the process of auto loading or repeating firearm. If the cartridge case comes into contact in anyway with any area inside the firearm it could leave behind striation marks of any form. These forms of striation marks include: ejector marks, extractor marks, chamber marks, firing pin drag marks, and shear marks. One of first types of striation marks is ejector mark....   [tags: balistics, criminology] 1280 words
(3.7 pages)
Research Papers [preview]
How Paint Used To Be Made - How it’s made Ingredients: Water, latex (for adhesion), titanium dioxide, calcium carbonate, potassium, zinc (for mildew resistance), and whatever additives that particular paint needs. · Water is pumped into a large mixing tank. Thickening and stabilizing agents are added to prevent the ingredients from settling to the bottom of the tank or can. · One at a time, all ingredients except for latex are mixed in. Each ingredient has a specific mixing time. This step is critical for quality. · This liquid is pumped to another large mixing tank that contains the latex....   [tags: environment, lead paint, oil paint]
:: 1 Works Cited
1206 words
(3.4 pages)
Better Essays [preview]
Identifying Novel Solo-LTRs Within an Individual - Q.1. To determine the solo-LTR region I first ran an electronic PCR on s240c3, s165c5 and s399c8 primers. I then aligned the PCR products to each other using a series BLAST searches, identifying a related sequence of ~968bp expected to be the same in each PCR product. Using BLAST I identified the start and end points of this sequence in relation to each of the PCR products of the 3 primers used in the experiment, allowing me to determine the direct repeats and thus pick out the Solo-LTR sequence and pre-integration site....   [tags: Research Analysis] 1982 words
(5.7 pages)
Powerful Essays [preview]
cDNA Experiment Results - Materials and Methods: Subjects The cDNA was produced by reverse transcriptase from total RNA by using superscript II (Invitrogen). The cDNA were from the lung which was obtained commercially from Ambion, HASM which was extracted in house and HBEC which was obtained commercially from Lonza. Primer Design Oligonucleotide primers were designed by obtaining the reference sequences for uPA, PAI-1 and PAI-2 from National Centre for Biotechnology Information (NCBI). The sequences were checked using NEBcutter (V2.0) to identify the common restriction enzymes sites that are not included in the sequences to be able to clone into pcDNA3....   [tags: cDNA Experiment Results ] 1285 words
(3.7 pages)
Strong Essays [preview]
Molecular Characterization of Brucella Abortus from Cattle and Buffaloes - ... All the nine isolates were confirmed by PCR using two sets of primers F4/R2 and B4/B5 which amplified 905bp and 223bp, respectively (Fig. 1 & Fig. 2). Twelve samples were positive by PCR (Fig. 3) utilizing genus specific primers F4 and R2 targeting 16S rRNA gene of B. abortus and amplified 905bp region. There are higher number of commensal bacteria and low number of Brucella in foetal membranes and vaginal mucus samples, which made isolation difficult. Fekete et al. (1990) also determined sensitivity of PCR with different concentrations of genomic DNA of Brucella abortus S-19....   [tags: bovine brucelosis disease]
:: 10 Works Cited
1275 words
(3.6 pages)
Better Essays [preview]
Bacteria strains and DNA extraction - Materials and method Bacteria strains and DNA extraction A collection of standard bacterial strains containing E. amylovora strains and several species of bacteria confirmed by Biochemical, Carbohydrates and Virulence tests for identification of E. amylovora isolates (data not shown) were exploited to estimate the specificity test (table 1). Furthermore, in order to assess the performance of two PCR methods and LAMP assay, about 208 symptomatic plant samples, were used. This collection was obtained from various plant tissues (e.g., flowers, shoots, leaves, fruits, and limbs) belonging to apple, pear and quince cultivars of different regions of Iran, during spring and summer of 2009 and 2010....   [tags: Biology, DNA] 2261 words
(6.5 pages)
Strong Essays [preview]
Polymerase Chain Reaction - ... After 48 hrs., total protein was extracted using lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris, pH 8.0). Equal amounts of total proteins were used for 12% PAGE electrophoresis followed by transferring and blocking in 3% skim milk. The specific polyclonal antibody against NS3 (Abcam) was used in 1/400 dilution followed by incubation with horse radish peroxidase-conjugated secondary antibody (Invitrogen). Presence of antigen-antibody complex was shown by enhanced chemiluminescence according to the manufacturer’s protocol (Takara)[14]....   [tags: chemical analysis] 538 words
(1.5 pages)
Strong Essays [preview]
Analizando El Poema Desde el Puente Martin Peña de Julia de Burgos - Leer la poesía de Julia de Burgos es abrirse paso a un mundo de emociones, luchas y temas múltiples. En sus tres poemarios, la poeta inaugura un estilo y unas temáticas que en ocasiones coinciden y en otras se apartan de los poetas entre los que convivió (López Jiménez, "Julia de Burgos” 141). Julia buscó abrirse paso hacia nuevas formas de escritura y trazar rutas alternas a los cánones establecidos, tanto por sus contemporáneos como por la tradición literaria. Poema en veinte surcos, su primer libro publicado en 1938, representa ese anhelo de trazar múltiples rutas mediante las cuales pueda realizar una búsqueda de nuevas voces, perspectivas y temáticas....   [tags: poesia, poema, Caño Martin Peña] 2595 words
(7.4 pages)
Powerful Essays [preview]
Global Warming: The Gradual Rise in the Temperature of the Earth's Surface - ... Greenhouse gases prevent heat from escaping into space. They are critical in keeping our planet alive, and allowed an explosion of life on our planet. In the Cambrian Period, greenhouse gases were eighteen times higher than today. A Global Warming Primer National Center for Policy Analysis. 2013. 21 Nov. 2013. Green house gases make up no more than two percent of the earth's atmosphere. Ninety five percent of greenhouse gases are water vapor....   [tags: environmental issues, climate change] 1021 words
(2.9 pages)
Better Essays [preview]
Threat of New Entrants to Retail Business - ... Unless a retailer carry exclusive products and services, or can compete heavily on prices, then consumers will have little to no switching costs. Competitive Rivalry Rivalry in the retail industry is high since there are numerous competitors sharing the same market. Even retail giants find themselves in competition with traditional stores, because they are people’s go-to when they run out of something, especially if they need it right away and they do not need a large amount of it. 4.9 Competitor Analysis – Primer Group of Companies Being involved in the retail and distribution of apparel in the country, Primer Group of Companies faces intense competition in the industry....   [tags: buyers, suppliers, competition]
:: 1 Works Cited
695 words
(2 pages)
Better Essays [preview]
The Forest of Hands and Teeth - John Adam's once said: “Because power corrupts, society's demands for moral authority and character increase as the importance of the position increases.” This quote is perfect for describing how a dystopia might come to be. Oftentimes, dystopias are a fictional universe where the world has been distorted (What is Dystopian Literature?). Dystopian societies often include a shift in control and a hero who recognizes that this society is indeed corrupt (What is Dystopian Literature?). Generally there is an unresolved climax at the end of the story where the hero might fail to succeed, but gives hope to the future (What is Dystopian Literature)....   [tags: power, society, utopia]
:: 14 Works Cited
1972 words
(5.6 pages)
Term Papers [preview]
The Human Genome and DNA Sequencing - ... Firstly dimethyl sulphate selectively attacks purines (Adenine and Guanine) or Hydrazine selectively attacks pyramidines (Cytosine and Thymine) by breaking the glycosidic bond between the base and ribose sugar. *show fig* The piperdine catalyzes the phosphodiester bond cleavage where the base has just been removed. *show fig* Fragments of this cleavage are resolved by size using polyacrylamide gel electrophoresis. Sanger Sequencing In the Sanger method, also called the Chain- termination method, the DNA molecule is firstly denatured using heat so that the DNA splits into its template strand and a complementary strand....   [tags: biology, genetics] 1341 words
(3.8 pages)
Research Papers [preview]
Domestic Partnerships Should be Legal - On June 26, 2015, the US Supreme Court ruled that the US Constitution guarantees the right for same-sex couples to marry. Should gay marriages be legal. Clearly we as a nation are undecided on this issue. Gay rights groups are fighting for rights while religious groups are fighting against gay marriage. I do NOT believe it is fair to discriminate against gays for being together. America is a free country and people should be able to be in a relationship with whomever they desire....   [tags: Anti Gay Marriage, argumentative essay]
:: 3 Works Cited
960 words
(2.7 pages)
Better Essays [preview]
Ethical Issues of Genetic Screening - Ethical Issues of Genetic Screening Introduction As we approach the 21st century, we as a society are increasingly bombarded with technical advances. One such area of advancement is the research involved with the Human Genome Mapping Project (HGMP). HGMP is a multi-billion dollar world wide research collaboration interested in sequencing the entire human genome. Started on October 1, 1990, with a group of over 350 labs, and expected to finish within the next 5 to 7 years, the Human Genome Mapping Project has given rise to many important advancements and many discoveries about the genetic make-up of humans (Bylinsky, 1994)....   [tags: Science Genetics Ethics Papers]
:: 12 Works Cited
2857 words
(8.2 pages)
Powerful Essays [preview]
The DNA Replication Process - All living things on earth are made up of cells that contain DNA. Deoxyribonucleic acid or DNA is the genetic material of living things that can be found in the nucleus of the cells (Alcamo, 1996). It contains the genes and the genetic codes that contain the information that are essential for life’s functions which are passed from generations to generations. DNA composes of two polynucleotide chains twisted around each other in the form of a double helix. According to Alcamo (1996), each strand of the DNA double helix can act as a template for the synthesis of a new complementary strand as it contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its p...   [tags: genetic material of living things]
:: 5 Works Cited
1143 words
(3.3 pages)
Strong Essays [preview]
The Chemistry of Painting Cars - The Chemistry of Painting Cars It is necessary to paint cars because the paint protects the steel of the car from corrosion, paint fills and smooths out any imperfections in the steel surface and it provides a durable, decorative, glossy appearance. If rusting continually takes place the car becomes unsafe. When water and oxygen come in contact with the metal of the car surface, several redox reactions happen. The oxygen is reduced to hydroxide ions and iron is oxidized to Fe2+ ions which pass into solution....   [tags: Papers] 1045 words
(3 pages)
Strong Essays [preview]
Scanning Electron Microscope - In the forensic science field there are various machines used to examine physical evidence. One of those instruments is the scanning electron microscope (SEM). This instrument can be used in examining physical evidence found at crime scenes. There have been a number of scientists that have developed and improved the SEM. SEM is very significant in forensics because it can narrow down size, shape, and chemical composition. The scanning electron microscope is always growing and becoming a great impact on forensic science....   [tags: forensic science, evidence]
:: 2 Works Cited
921 words
(2.6 pages)
Better Essays [preview]
El gobierno de Brasil y los estadios del Mundial - ... En este estadio se ahorrarán alrededor de un 30% de consumo agua debido a unas cisternas que reciben y filtran la lluvia, para después regar el campo y abastecer los retretes. Así mismo se ahorrará un 8 por ciento de la cuenta de luz gracias a las 23,500 bombillas de led de bajo consumo y a los 1500 paneles solares fotovoltaicos. Estas medidas de ahorro en cierta forma compensan la inversión de cerca de 560 millones de dólares que costó la en la reforma de dicho estadio El estadio Castelao – Fortaleza en este estadio se hace una combinación excelente entre la ecosostenibilidad con la tecnología....   [tags: brasilia, mineirao, demoliciones] 529 words
(1.5 pages)
Strong Essays [preview]
How Will Peak Oil Change The World? - ... 13 Nov. 2011. <>. DeFotis, Dimitra. "How Close is Hubbert's Peak?" Barron's 85.40 (2005): 46,46-47. ProQuest. Web. 17 Oct. 2011. Dunlop, Ian. "Peak Oil Drives Urgent Energy Alternatives." Australasian Science 2008: 37,37-39. ProQuest. Web. 17 Oct. 2011 <>. "EROI And EIRR." Clean Energy Wonk. Web. 11 Nov. 2011. <>....   [tags: produce, middle east, energy]
:: 28 Works Cited
583 words
(1.7 pages)
Term Papers [preview]
Structural Elements of Toni Morrison's The Bluest Eye - The Bluest Eye: Structural Elements In The Bluest Eye, Toni Morrison employs structure as an aid for telling her story. She uses at least three unique structural devices for this purpose. First, Morrison begins the novel with three passages that prepare the reader for the shocking tale about to be told. Second, the novel is divided into four major parts with each quarter given the name of a season. Third, the novel is further divided into seven sections that are headed by a portion of the passage that began the novel....   [tags: Bluest Eye Essays] 948 words
(2.7 pages)
Better Essays [preview]
Stem Cells: What How and Why? - Stem Cells: What, How and Why. Stem cells are infinitely valuable when considering their potential applications in the medical profession. While current legislative restrictions have halted the development of new ?stem cell lines. to any agency or company that receives any form of governmental grants, there is no question that the medical profession is standing at the brink of a new era of technological advancements in healthcare and research. Stem cells are valuable due to the fact that they are ?non-designated,....   [tags: essays research papers] 1133 words
(3.2 pages)
Strong Essays [preview]
The Question of Biology is "Why?" - ... Now, we can look at how DNA replication begins. DNA replication begins by unwinding the two DNA strands; an enzyme called helicase accomplishes this. This enzyme uses energy from ATP to unwind the template strand, but like any other process it encounters problems that it must overcome. When DNA is unwound a phenomena called supercoiling can occur—when the DNA is unwound the DNA helix will continue to coil over in space. To overcome this an enzyme called DNA gyrase that helps in relieving the torque that is produced by the unwinding of DNA; this enzyme essentially prevents the helix from supercoiling by changing the topological state of the helix....   [tags: DNA replication, enzymes, polymearse] 1520 words
(4.3 pages)
Powerful Essays [preview]
The Structure of Nucleic Acid Chains - The Structure of Nucleic Acid Chains Nucleotides are joined together in DNA and RNA by phosphate ester bonds between the phosphate component of one nucleotide and the sugar component of the next nucleotide. An ester bond is a bond which occurs between a Carbon atom and an Oxygen atom. More and more nucleotides can be added on by the same process of forming ester bonds until an immense chain is formed. But no matter how long a polynucleotide chain is, one end of the nucleic acid molecule always has a free -OH group on the sugar at the Carbon known as C3' (called the 3' end) and the other end of the molecule always has a phosphoric acid group at C5' (the 5' end)....   [tags: Papers] 906 words
(2.6 pages)
Strong Essays [preview]
Chemical Communication in Mammals - Chemical Communication in Mammals Chemical Communication in Mammals In mammals they use a few types of communication and one of them is called Chemical Communication also known as Pheromones. These chemical messengers square measure transported outside of the body and have an effect on neurocircuits, as well as the autonomous system with secretion or protein mediate physiological changes, inflammatory sign, system modifications and/or behavioral change within the recipient. There are physical limits on the sensible size of organisms using pheromones, as a result of at little sizes secretion diffuses far from the supply organism quicker than it is created, and a wise concentration accumulat...   [tags: physical limits, pheromones, neurocircuits]
:: 1 Works Cited
1324 words
(3.8 pages)
Strong Essays [preview]
DNA Replicaiton Cause Cancer - ... Diet also lead people to cancer, consumption of red meat in big amount with specific amount of time could lead to intestine cancer. Nitrates and nitrites in meat interfere botulinic exotoxin production in the body (Divisi, Tommaso, Salvemini, Garramone, Crisci, 2006). People who are obese have a higher risk of cancer than the normal people are. V. Treatment People with cancer must be treated with particular treatment as it’s a state where they could be really sensitive about themselves and about the disease, cancer not only makes people down physically but also attack people’s mentality....   [tags: oncological analysis]
:: 6 Works Cited
1551 words
(4.4 pages)
Term Papers [preview]
Endoscopy and Gastric Histology - ... The histological sections were stained with hematoxylin-eosin and they were evaluated by a pathologist using the updated Sydney System criteria (13). Therefore, endoscopic observation and histopathological confirmations were used to determine patient pathology. Serology Five ml Peripheral blood samples were taken from all control subjects of the study. The serum was tested for IgG by enzyme-linked immunosorbent assay (ELISA; International Immuno-Diagnostics, Foster City, CA, USA) according to the manufacturer’s instructions....   [tags: serology, dyspeptic patients] 912 words
(2.6 pages)
Better Essays [preview]
Los Nacimientos o Belenes - ... Sin embargo, con el tiempo, el frío resultó muy incómodo para muchas personas y por lo tanto, las personas y animales se sustituyeron por figuras de barro. Se dice que fue en Nápoles, Italia a finales del siglo XIV que se montó el primer nacimiento con figuras de barro (Iglesias y Cabrera, 2009, p. 223). Los nacimientos llegaron a México a raíz de la conquista española alrededor del siglo XVI. Los frailes se valieron de esta costumbre navideña como un instrumento más para la evangelización de los indígenas....   [tags: tradiciones navideñas, niño jesus] 893 words
(2.6 pages)
Strong Essays [preview]
What is the Polymerase Chain Reaction (PCR) - The polymerase chain reaction or PCR for short can be used to create many copies of DNA. This allows the DNA to then be visualized using a dye like ethidium bromide after gel electrophoresis. The process has been refined over the years, however the basic steps are similar. The first is to denature dsDNA through heating to ~96 °C. This separates the two strands of DNA. The exact temperature to be used can be calculated with Tm = 4oC x (no. of G & C) + 2oC x (no. of A & T). Tm is the melting point of the strands and to supply the number of G, C, A, & T ‘s the primer is used....   [tags: DNA, genealogy, biomolecular science]
:: 1 Works Cited
1027 words
(2.9 pages)
Strong Essays [preview]
The Behavior of HL-60 Cells - ... This process involved heating up the isolated RNA to 80 degrees C after being centrifuged with the RD Buffer that contained the primers for the reaction. Another buffer was also added afterwards which contains the reverse transcriptase enzyme, RNase inhibitor, and dNTPs. The reverse transcriptase enzyme used the viral RNA as a template to synthesize the complementary strand of DNA by adding nucleotides to short primers that bind to the RNA and make the cDNA. The next step in this experiment was to use the polymerase chain reaction to magnify the crucial genes in the cDNA....   [tags: humal leukemia cells, genetic medicine] 1392 words
(4 pages)
Research Papers [preview]
Morrison's Bluest Eye Essay: Conformity - The Bluest Eye: Conformity The basic theme of the novel, The Bluest Eye revolves around African Americans' conformity to white standards. Although beauty is the larger theme of the novel, Morrison scrutinizes the dominant white culture's influence on class levels. Morrison sets the foundation of the novel on issues of beauty in an attempt to make African Americans aware that they do not have to conform to white standards on any level. Morrison's main character, Pecola Breedlove, unquestioningly accepts the ideology that white features correlate with beauty....   [tags: Bluest Eye Essays] 893 words
(2.6 pages)
Better Essays [preview]
Reminiscencia de la infancia: el caso de un escritor de los siglos XX y - Reminiscencia de la infancia: el caso de un escritor de los siglos XX y La primera primera ficción narrativa de Medardo Fraile, uno de los maestros de la Edad de Oro del cuento español contemporáneo, surgió a la edad de cinco años. La temprana edad de su escritura nos lleva a investigar sobre los hechos que acompañaron su infancia y que pudieron despertar en él esa necesidad de crear. La lectura de su obra narrativa, vinculada a su biografía, así como alguno de sus numerosos artículos, nos confirman el efecto que produjo en Medardo Fraile niño la ausencia de su madre, fallecida meses antes del surgimiento de ese primer cuento....   [tags: Foreign Language Spanish Essays] 3034 words
(8.7 pages)
Strong Essays [preview]
Compare venom and venom gland sequences for VEGF-F - Abstract: Snake bite is a major health problem in developing countries. And the recent treatments have many limitations such as: efficiency, side effect and expenses. Designing new antivenom is base on generating a DNA plasmid containing the most immunogenic motifs of the venom toxins in order to generate antibodies to this plasmid; next it is injected to a camel, then the extracted antibodies used as antivenom. The aim of this study to compare between the venom gland and the gland transcriptomes, hoping that using the venom as a source of mRNA will avoid sacrificing the snake....   [tags: Venom Treatment]
:: 15 Works Cited
2460 words
(7 pages)
Term Papers [preview]
Cloning, Expression, Characterization and Purification of Endoglucanase Gene - DISCUSSION Endo-1, 4-B-glucanase is an important enzyme from industrial point of view and its production is considered essential for successful utilization of cellulosic materials (Wu and Lee 1997., Zhang and Lynd 2004). The objective of present research work was cloning, expression, purification and characterization of endoglucanase (bgl C) gene obtained from strain of Bacillus licheniformis ATCC 14580. Isolation of high quality genomic DNA is a prerequisite for molecular techniques (Ansari et al., 2012)....   [tags: bacilus licheniformis] 2561 words
(7.3 pages)
Research Papers [preview]
Francisco de Holanda y Felipe de Guevara: Inventar, Imitar y el Arte Universal - ... Para De Holanda, el debujo, este primer contacto entre mente y realidad permite al artista dotar a su obra de “proporción y geometría … decoro y decencia”, cualidades que él considera son “la fuerza” sobre la cual se basa el arte. Sin embargo, De Holanda es muy claro en cuanto a la fuente de dicha fuerza; para él, la idea original es finalmente creación de Dios mismo pues el artista debe idealizar e imitar la naturaleza pero, dada nuestra condición como parte de la creación divina, también es este debujo naturaleza en sí mismo....   [tags: humanismo, escultura, pintura y agricultura] 1043 words
(3 pages)
Better Essays [preview]
Cien años de soledad por Gabriel García Márquez - ... En la obra se describe, de igual manera, cómo se llevaría un sinnúmero de conflictos liderados principalmente por un personaje homólogo a Rafael Uribe Uribe: el coronel Aureliano Buendía. Por lo que se refiere a los contextos sociales, existen dos datos que se relacionan de igual manera con el contexto histórico colombiano. El primer dato se relaciona con la llegada del ferrocarril a Colombia. En 1882 se funda el Ferrocarril de Santa Marta, que sirvió principalmente para el transporte y comercialización del banano en Colombia por la empresa norteamericana “Santa Marta Railway Company United”....   [tags: historia, realismo mágico] 756 words
(2.2 pages)
Better Essays [preview]
Auto Body Repair - Auto Body Repair Imagine you’re driving down the road in your brand new car. Another driver pulls out from a side road and suddenly the whole side of your brand new car is twisted and dented from fender to fender. Most people will be in an automobile accident at some point in their lives and they will require the services of an auto-body repairman. Auto body repair is not only the art of taking damaged vehicles and making them drivable and safe, it is also taking old vehicles or worn out looking vehicles and painting and freshening up their overall appearance....   [tags: appearance, body work, metal finishing] 2102 words
(6 pages)
Powerful Essays [preview]
Screening of Chlamydia trachomatis Infection in Men, Is It Necessary in Iran? - Introduction Today, Sexually Transmitted Infections (STIs) are a main public health problem in the world and they are among the 10 major cause of unpleasant disease in young adult men worldwide (1). While Chlamydia trachomatis (CT) known as a common bacterial cause of STIs with adverse sequels (e.g. infertility), many countries have not national standard program for routine screening of CT in males (2). Development of currently available screening tests for noninvasive specimens (such as Nucleic Acid Amplification Tests (NAATs) in urine samples) with high accuracy and reliability, leads to earlier detection of infection in people and improvement of health outcomes in many countries (3)....   [tags: Sexually Transmitted Infections]
:: 19 Works Cited
957 words
(2.7 pages)
Better Essays [preview]
Entamoeba Histolytica: Biochemical Characterization of a Protein Disulfide Isomerase - The oxidation and correct formation of disulfide bonds is an important biochemical modification of many proteins. Early observations showed that disulfide bond formation proceeds much faster in vivo than in vitro, suggesting the existence of a catalyst for protein oxidative folding in living cells [1]. Protein disulfide isomerase (PDI, EC is a eukaryotic oxidoreductase that catalyzes the oxidation, reduction, and isomerization of disulfide bonds in nascent polypeptides [2]. The subcellular localization and its function suggest that PDI plays a key role in the folding of proteins delivered to the secretory pathway [3]....   [tags: Biochemistry]
:: 25 Works Cited
2669 words
(7.6 pages)
Term Papers [preview]
The Zebra Fish and Human Diseases - 1.0 Introduction 1.1 Zebra Fish The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8)....   [tags: genome, research, obesity]
:: 10 Works Cited
1477 words
(4.2 pages)
Powerful Essays [preview]
Origen del arte Islámico - ... Cada modismo se fue desarrollando gradualmente el arte y la costumbre, aunque ya reconocida con una identidad islámica, con el tiempo fue adquiriendo cada quien su carácter individual. La Religión Islámica Quien tiene como profesión la religión Islámica, siempre tiene como legado de que “No hay otro Dios, sino que Dios y Mahoma que es su profeta. necesario pronunciar estas palabras al frente de dos testigos y automáticamente se convierte en musulmán, claro que después de convertirse en musulmán tiene que seguir al pie con todo lo que se le inculca a los musulmanes....   [tags: religión, tradiciones, persia, egipto] 594 words
(1.7 pages)
Strong Essays [preview]
El Estatuto real de la Constitucion de 1837 - MODERADOS Y PROGRESISTAS DURANTE LA MINORIA DE ISABEL: EL ESTATUTO REAL Y LA CONSTITUCION DE 1837 Tras la muerte de Fernando VII su hija Isabel fue proclamada reina. Moderados y progresistas agrupaban de forma caótica a todos los liberales, los primeros incluso a algunos absolutistas moderados. El 6 de Octubre de 1833 la regente Maria Cristina adoptó una medida para acercarse al liberalismo: la declaración de indulto general y de amnistía El primer gobierno de Maria cristina estuvo presidido por Cea Bermúdez....   [tags: Spanish Essays] 844 words
(2.4 pages)
Strong Essays [preview]
Polymerase Chain Reaction - One may view cloning as copying a living thing and producing multiple copies. People may think of cloning rabbits, sheep or humans. In the field of molecular biology, however cloning is viewed at a genetic molecular level, where a piece of DNA is copied on a large-scale by genetically copying tens to hundreds of thousands of identical DNA fragments. Researchers are developing new methods of cloning by using polymerase chain reaction (PCR). PCR was introduced in the 1980s and in recent years Kary Mullis won the Nobel Prize in Chemistry for his invention of PCR....   [tags: Cloning]
:: 4 Works Cited
999 words
(2.9 pages)
Strong Essays [preview]
Bacteria Resistant to Penicilin - ... During 1980, TEM and SHV broad spectrum beta lactamases caused ESBL expansion and generally related to Klebsiella pneumoniae which include in nosocomial out breaks but in last decade until now CTX-M-type ESBL have spread greatly as the most common ESBL worldwide and main reason of infection in both community and hospital specially in E.coli.(6) Every year, various health care organization and research centers publish their data about ESBL prevalence by focus on dominant genes and their spreading mechanism and geographical epidemiology....   [tags: esbl, beta-lactam antibiotics] 807 words
(2.3 pages)
Better Essays [preview]
Neanderthal and Early Modern Humans - Neanderthal and Early Modern Humans The history of life on earth goes back to millions of years. Many species and creatures evolved and changed through time, leading up to what we know today as, modern man. One of the creatures most similar to modern man is the Neanderthals; they are sometimes referred to as “early modern humans.” An article entitled “Early man steered clear of Neanderthal romance” by Michael Hopkin, explains that there was a discovery that early human ancestors of modern man did not breed with their “cousins,” the Neanderthals, according to DNA that has been studied....   [tags: Exploratory Essays Research Papers]
:: 3 Works Cited
1348 words
(3.9 pages)
Strong Essays [preview]
Woman Is The Nigger Of The Wolrd: The Bluest Eye by Toni Morrison - ... I am cute!” (Morrison, 56-57), which proves she needs to juxtapose black with cute in order to feel cute herself. Therefore, the vacuum of white people looking upon African-Americans as a different species is mainly based on racial stereotypes. This theme of the white gaze is prominently worked out in the book through eye-imagery, which stresses that one also ought to look at racism from the victim’s perspective. With this Morrison offers a view for white readers how anti-black racism works, which may lead to the readers tracing if they themselves behave this way....   [tags: race, human recognition, african americans]
:: 2 Works Cited
921 words
(2.6 pages)
Better Essays [preview]
Correlation of Wood Type and Surface Coatings with the Resistance of Water Absorption - ... I proceeded to place the wood treated with latex paint and oil based stain in their corresponding buckets. I covered each bucket with plastic wrap to prevent the evaporation of water, which would greatly interfere with my results, and secured the wrap with a rubber band. I then covered the buckets with a lid and placed them in my basement. I left them untouched for seven days, from December 21, 2013 to December 28, 2013, at a constant temperature of about 21.17C (room temperature). On December 28, the end of the seventh day, I removed each piece of wood from the buckets, but allowed any extra water clinging to it to drip back into the bucket for fifteen seconds....   [tags: softwoods or hardwoods, maple, poplar ]
:: 8 Works Cited
2373 words
(6.8 pages)
Research Papers [preview]
Filosofía, Coyuntura e Ímpetu: Las Fuerzas del Origen de la Independencia Chilena - ... No se habían incorporado los conocimientos y avances científicos que se encontraban en auge en Europa, había muy pocos recursos bibliográficos y en la cotidianeidad prevalecían principios tradicionales-colonialistas obsoletos. En medio de este retraso cultural, progresivamente fueron llegando libros desde Europa a través de barcos y viajeros que empezaron a configurar nutridas colecciones y bibliotecas privadas. Los títulos de los principales autores Ilustrados como Rousseau, Montesquieu, Diderot, junto con sus modernos aportes filosóficos sobre derechos, poder y libertad, comenzaron a circular entre los letrados de la época, en cuyas tertulias se discutían los temas de actualidad, siend...   [tags: historia de Sur América] 1321 words
(3.8 pages)
Better Essays [preview]
El Paquete de Bali: Un Planteamiento de Ganancias Sin Acciones Claras - ... Al liberalizar el comercio, como se pretende con este acuerdo, los países más vulnerables se verán afectados por políticas impuestas por mercados más estables. Si bien el acuerdo que se logró en Bali, que se espera que entre en vigor en un año, será aplicado una vez sea ratificado por aquellas naciones que posean las capacidades de inversión, podrán ir aplicándolo por plazos. Aquellos que no lo ratifiquen y no estén obligados a cumplir no tendrán ninguna sanción, es decir, “Solo se logró el compromiso político de todos los miembros de la OMC de “ejercitar la mayor autorrestricción con respecto al recurso a subsidios a la exportación” (Cárdenas 2013) y aunque esto lleva a la especializaci...   [tags: productos agricolas, comercio] 1206 words
(3.4 pages)
Strong Essays [preview]
History of American Education, and No Child Left Behind - 1620-1776 Precess, Boundaries Colonial America of 1620-1776 began the system for free public education for all New England colonies except Rhode Island. Has this system for free schools been maintained in part by “public funding?’ The Puritans believed the local governments should see to it that all children learned to read the Bible. Without being able to read the Bible, the children would not know how to denounce Satan. The Eight General Assembly, provided, for the people of each county, by a two-thirds vote to tax themselves three and one-third cents per dollar for school purposes....   [tags: NCLB, Public Education] 1046 words
(3 pages)
Strong Essays [preview]
Maple Syrup Urine Disease: a Dreaded Recessive Abnormality - Maple Syrup Urine Disorder (MSUD) is a genetic disorder caused from a mutation arising from a deficiency in one of six proteins that collectively form the branched-chain alpha-keto acid dehydrogenase (BCKD) complex (Genetic Science Learning Center). MSUD is characterized by heightened plasma levels in the branched-chain amino acids and excretion of branched-chain keto acids producing a maple syrup aroma (Pangkanon, Charoensiriwatana, and Sangtawesin 41-43). MSUD is an autosomal recessive disorder which means an individual must inherit a copy of the MSUD gene from both of his/her parents to be affected....   [tags: Medical Conditions]
:: 4 Works Cited
939 words
(2.7 pages)
Better Essays [preview]
Research on the Expressed Sequence Tag of Olives - ... They were then added with glycerol. The library was stored at −80˚C. The above steps were done separately for the two cDNA library. Sixty clones randomly selected. Alkaline lysis method was used to isolate plasmid DNA from the clones selected previously. Bgl1701 was then used to digest the DNA. Polymerase chain reaction (PCR) was carried out to amplify the clones to create library. 3840 clones were selected randomly to be used as PCR template. M13 universal primer was used as primer in PCR. Automated sequencing was performed using the ABI 3730 capillary sequencer (PE Applied Biosystems) to obtain the sequences of clones....   [tags: genetics, clones, library] 775 words
(2.2 pages)
Strong Essays [preview]
‘Hypercholesteremia Elevates Level of Cholesterol in the Blood - ... fermentum also naturally inhabits human gastrointestinal tract and affords resistant to bile-toxicity by producing BSH, which is involved in the removal of conjugated amino acid moiety of bile acids (Tannock et al., 1989). Earlier, we have reported the potential probiotic properties of L. fermentum MTCC 8711 (Jayashree et al 2010). Recently, we have reported the whole genome sequence of L. fermentum MTCC 8711 by shot gun sequencing technique (Jayashree et al., 2013). The bsh gene was identified from the draft genome....   [tags: cardiovasular disease, bile salt, health] 1438 words
(4.1 pages)
Better Essays [preview]
Agricultural and Ecological Role of the Honey Bee - ... The round dance only has one component. Bees run one way in the circle, stops and then run the other way (Waddington, 1982). Honey bees can also use trophallaxis or the exchange of food to communicate a range of information. Trophallaxis is mainly used to communicate the need for water, the quality of food sources, temperature, and the condition of the queen (Korst et al., 1982). Primer pheromones are another form of communication used by the western honey bee to distribute labor efficiently....   [tags: waggle dances, communication, odor] 1962 words
(5.6 pages)
Term Papers [preview]
La Criminología ambiental aplicada a la delincuencia juvenil - ... A consecuencia de esto, puede surgir una ruptura del individuo con el sistema establecido y llegar así a delinquir. Para establecer lo que es y cómo está considera la etapa juvenil, manifestar en primer lugar que es una etapa difícil, de experimentación y cambios. Un periodo de la vida donde se abandona la infancia y se entra a formar parte de la edad adulta. La juventud abarca desde los 10 hasta los 24 años, clasificándose en tres etapas; la adolescencia inicial de 10 a 14 años, la adolescencia tardía de 15 a 19 años y la juventud plena de 20 a 24 años....   [tags: ] 1169 words
(3.3 pages)
Research Papers [preview]
Hospital Trends in The Current Economic Environment - Hospital Trends 1. How is the current economic environment affecting hospitals. According to the article, “The Economic Downturn and Its Impact on Hospitals”, the current economic environment is affecting hospitals and other heath care facilities in a number of ways. The most common issue relates to inability of the hospitals to obtain and secure relevant financing that enables health institutions to meet their daily obligations. Since most payments in hospitals lags behind the amount expected to deliver health care, most of the times hospitals are forced to borrow funds from financial institutions to meet their operating expenses....   [tags: Hospital Administration]
:: 3 Works Cited
1043 words
(3 pages)
Better Essays [preview]
Blackberry Breeders have Implement Morphological Marker-assisted Selection - Blackberry breeders have implement morphological marker-assisted selection for thornlessness using Rubus L, which trigger development of molecular marker for blackberry cultivation. However, no genetic map and molecular marker exist for cultivation purpose. Therefore, the purpose of this study is to develop genetic map, molecular markers, or first blackberry expressed sequence tag (EST) library. The newly release of two blackberry (Rubus L) cultivars with new trait, primocane fruiting has the potential to expand the industry by combining primocane fruiting with useful trait such as thornlessness....   [tags: EST sequence, blackberry cultivars, rna]
:: 1 Works Cited
879 words
(2.5 pages)
Better Essays [preview]
Early American Education and Early Education Laws - “The philosophy of the ____schoolroom______ in one generation will be the philosophy of ____goverment________________ of the next.” – Abraham Lincoln EARLY AMERICAN EDUCATION Harvard Started by the Congregationalist, Harvard was founded as a school that trained men for the ministry of being a pastor (Barton, (2004)). Its philosophy was “Christ and the church and to the glory of God” (Barton, (2004)). This school produced great men such as Cushing, Pickering and many more that would lay a Godly foundation for education (Barton, (2004))....   [tags: harvard, yale, princenton]
:: 2 Works Cited
1186 words
(3.4 pages)
Strong Essays [preview]
How To Be A Good Entrepreneur - Question 1 What are the steps to be a good entrepreneur. Write your suggestion and recommendation based on your observation and experience in Malaysia. 1.0 Introduction An entrepreneur is a person who organizes and manages a business undertaking, assuming the risk for the sake of profit. According to Martin (2010) an entrepreneur sees an opportunity which others do not fully recognize, to meet an unsatisfied demand or to radically improve the performance of an existing business. To have self-belief that this opportunity can be made real through hard work, commitment and the adaptability to learn the lessons of the market along the way....   [tags: Entrepreneurship, Business Planning, Career]
:: 7 Works Cited
1033 words
(3 pages)
Strong Essays [preview]
Side Effects: Why drugs Are Poision - ... This short cut method gave rise to what is now known as side effects. The change in how we make our medications from the alchemical process to the chemical process is to blame. We see the side effects that cause the most damage in the medication that treat mental illnesses. The Citizens Commission on Human Rights says "Psychotropic drugs are increasingly being exposed as chemical toxins with the power to kill. Psychiatrists claim their drugs save lives, but according to their own studies, psychotropic drugs can double the risk of suicide....   [tags: medicine, chemical process]
:: 4 Works Cited
986 words
(2.8 pages)
Better Essays [preview]
Reconstitution: An Effective Strategy for Nimitz? - ... The second is that 90-100 percent of all students need to be actively engaged in all class rooms. Third is to reduce the number of students losing instructional time due to discipline by 10 percent. And lastly, to reduce teacher and student absences by 25 percent. Studies done by Jennifer Rice King and Betty Malen on the threat of Reconstitution show that, in many cases, it had little motivational impact because educators didn’t believe the threat would actually be carried through. On the other hand, some studies show that teachers did become more motivated, but only in the short run; instead of working with the students who are struggling to pass, teachers will focus on the those who ar...   [tags: tests, progress, standard, threat]
:: 6 Works Cited
658 words
(1.9 pages)
Better Essays [preview]

Your search returned over 400 essays for "primer"
1  2  3  4  5    Next >>