Search Results

Free Essays
Good Essays
Better Essays
Stronger Essays
Powerful Essays
Term Papers
Research Papers

Your search returned over 400 essays for "DNA"
1  2  3  4  5    Next >>

These results are sorted by most relevant first (ranked search). You may also sort these by color rating or essay length.

Title Length Color Rating  
DNA and Enzymes - Have you ever asked yourself the question why my eyes are this color. Or any question as to why we look the way we do. All of our features come down to our genetics. Those genetics are family traits that are passed down through our bloodlines. It all comes down to what is considered the fundamental building blocks of life, our DNA. DeoxyriboNucleic Acid is the actual name for DNA. We have all heard of DNA for years, but what do you really know about it. What is DNA made of. In this paper we will talk about this mini miracle called DNA....   [tags: DNA Essays]
:: 12 Works Cited
1431 words
(4.1 pages)
Strong Essays [preview]
Use of DNA in Criminal Investigations - Before the 1980s, courts relied on testimony and eyewitness accounts as a main source of evidence. Notoriously unreliable, these techniques have since faded away to the stunning reliability of DNA forensics. In 1984, British geneticist Alec Jeffreys of the University of Leicester discovered an interesting new marker in the human genome. Most DNA information is the same in every human, but the junk code between genes is unique to every person. Junk DNA used for investigative purposes can be found in blood, saliva, perspiration, sexual fluid, skin tissue, bone marrow, dental pulp, and hair follicles (Butler, 2011)....   [tags: DNA Forensics]
:: 6 Works Cited
2857 words
(8.2 pages)
Research Papers [preview]
DNA in the Forensic Science Community - This paper explores deoxyribonucleic acid (DNA) collection and its relationship to solving crimes. The collection of DNA is one of the most important steps in identifying a suspect in a crime. DNA evidence can either convict or exonerate an individual of a crime. Furthermore, the accuracy of forensic identification of evidence has the possibility of leaving biased effects on a juror (Carrell, Krauss, Liberman, Miethe, 2008). This paper examines Carrells et al’s research along with three other research articles to review how DNA is collected, the effects that is has on a juror and the pros and cons of DNA collection in the Forensic Science and Criminal Justice community. Keywords: deoxyribo...   [tags: Biology, DNA collection, DNA Evidence] 1511 words
(4.3 pages)
Better Essays [preview]
Bacteria strains and DNA extraction - Materials and method Bacteria strains and DNA extraction A collection of standard bacterial strains containing E. amylovora strains and several species of bacteria confirmed by Biochemical, Carbohydrates and Virulence tests for identification of E. amylovora isolates (data not shown) were exploited to estimate the specificity test (table 1). Furthermore, in order to assess the performance of two PCR methods and LAMP assay, about 208 symptomatic plant samples, were used. This collection was obtained from various plant tissues (e.g., flowers, shoots, leaves, fruits, and limbs) belonging to apple, pear and quince cultivars of different regions of Iran, during spring and summer of 2009 and 2010....   [tags: Biology, DNA] 2261 words
(6.5 pages)
Strong Essays [preview]
DNA: The Doble Helix - ... The word “double helix” comes into play to designate DNA’s structure, which is described to look like a twisted ladder. The steps on the ladder are the stored information in DNA that are made up of bases and they are, (A) Adenine, (G) Guanine, (T) Thymine, and (C) Cytosine. These bases are joined together by a sugar-phosphate backbone known as base pairs, as adenine pairs up with thymine and cytosine with guanine. DNA FINGERPRINTING How is it used in crime scene investigation. Discuss dna fingerprinting....   [tags: fingerprinting, dna testing] 1086 words
(3.1 pages)
Strong Essays [preview]
Enhancing the Power of DNA as an Investigative Tool - DNA is a double helix molecule that contains information that is used to make up a person’s body. DNA controls every aspect of a person’s body from their eye and hair color, height, and other features. DNA’s specific and unique characteristic can be crucial when solving a crime. DNA can be used to convict a suspect or exonerate an innocent person. When DNA is found it is even more important that is handle properly to ensure proper identification and accuracy of testing. The evolution of DNA technology is vital to the process of solving crimes, however the process by which DNA is found and handle can jeopardize its powerfulness....   [tags: DNA Investigative Tool] 2113 words
(6 pages)
Better Essays [preview]
Types of Bonds Present in a DNA Molecule - ... This week’s topic is also built upon previous topics. It helped that I had the background about atoms, molecules, and bonds from week one, and genes and mutations from last weeks topic on genetics. This section is important and relates to everyday life because it explains how the DNA and RNA that is used to create us are built. Our bodies are able to grow and change because our cells are constantly reproducing themselves. Our health and functioning of our bodies is determined by how the DNA and RNA is bonded; if it is not bonded correctly we will have health issues....   [tags: manipulation and reproduction of DNA]
:: 5 Works Cited
538 words
(1.5 pages)
Research Papers [preview]
Biology: Biome and DNA Identification Process - DNA forensics is a division of forensic science that focuses on the use of genetic material in criminal investigation to answer questions pertaining to legal situations, including criminal and civil cases. Through DNA testing, law enforcement officers are able to identify human remains or the individual responsible for a crime. DNA testing is a highly advanced scientific process that involves replicating the human DNA sequence to create a genetic map of an individual. Because of its reliability, DNA testing has become a significant factor in criminal cases....   [tags: biological diversity, forensics, dna testing] 1778 words
(5.1 pages)
Powerful Essays [preview]
Unraveling DNA - Unraveling the molecular mechanism of DNA binding by Transcription-activator like effectors Sequence-specific DNA targeting of nucleases, recombinases and transcriptional activators is a powerful tool to manipulate the sequence or regulate the expression of the gene of interest. While Zinc fingers specific to DNA trinucleotides, coupled to different effector domains have been employed for targeted manipulation of the genome with considerable success, we are limited by the off-target toxicity caused by trinucleotide specific zinc fingers....   [tags: DNA, TALE, Xanthomonas]
:: 2 Works Cited
1082 words
(3.1 pages)
Strong Essays [preview]
DNA barcoding of two species of Coffea (Rubiaceae) - Background of the Study Systematics and taxonomy involves identifying and resolving relationships among species. But with species today being more taxonomically complex, integrating molecular technology as an alternative tool in species identification has helped systematic s gain new perspective in evolutionary studies .Taxonomy has always been the forefront in the study of life and forever will be (Wheeler 2004). And with the increase in the development within the field of molecular biology and genetics, DNA is now used as a way in identifying species....   [tags: Taxonomy, Molecular Technology, DNA ]
:: 22 Works Cited
1320 words
(3.8 pages)
Strong Essays [preview]
What are DNA Sequence Motifs? Why are They Important? - ... These codes reflect the certainty of the type of nucleotide that occurs at a particular position. For example, the code [A] refers to Adenine, whereas [Y] stands for Cytosine or Thymine ( Consensus sequences are compact and suit enumerative based analysis, where a binary decision is sufficient (either a match or a mismatch). However, in some cases it is desirable to measure how well a genomic site matches a motif (it indicates the binding affinity)....   [tags: dna, genes, footprinting] 611 words
(1.7 pages)
Strong Essays [preview]
Creative Writing Assignment about a Rape and the Importance of DNA - Creative Writing Topic: Fred and Frank are identical twins who live in a rural village in England. A rape has occurred, and the police are asking for voluntary DNA samples to help narrow the search for the rapist. Fred is ready to volunteer for the DNA testing, when Frank asks him not to… In a small village somewhere in England Lived the two brothers Frank and Fred. Everything about them looked quite the same— Their eyes, nose, and hair on their head. Not many could distinguish Fred from Frank, As they were identical twins, The villagers, stumped, left the boys amused, Causing two identical grins....   [tags: rape, dna sampling, testing] 568 words
(1.6 pages)
Good Essays [preview]
DNA, The New Crime Investigator - DNA, The New Crime Investigator Abstract What is DNA. The scientific definition is “deoxyribonucleic acid, the biological polymer that stores the genetic information in all free living organisms. Two linear molecules entwine to form the double helix. Now that the definition has been stated, let’s now define what DNA means to a crime scene or case investigator. In the law enforcement business DNA has been introduce as a revolutionary and efficient accurate tool to solve and crack modern and cold cases....   [tags: DNA Crime Cimenology] 1352 words
(3.9 pages)
Strong Essays [preview]
In Vitro Fertilization: Ethical Problems of Mitochondrial DNA and Three Biological Parents - ... In this case the nucleus of the women's egg would be removed to a healthy womans enucleated egg. The formed egg would have nuclear DNA from the intended mother and mitochondrial DNA from the female egg donor and would then be fertilized by a sperm of the future father, thus resulting in three-party parenthood and hence the method is often called three-parent in vitro fertilisation. The transfer of the nucleus to an egg with healthy mitochondria also posses a possible risk. We don't know if we've accidentally damaged the previously healthy mitochondria in the transfer....   [tags: energy, cell, mitochondrila, dna] 785 words
(2.2 pages)
Better Essays [preview]
DNA Interactions Between Proteins - DNA: Interactions between Proteins Deoxyribonucleic Acid is a molecule that contains the genetic makeup of almost all living organisms. While Deoxyribonucleic Acid, or DNA, has been successfully mapped out, many of its interactions with certain proteins and enzymes have not been fully revealed within the atomic level. The history and mysteries of DNA continue to fascinate biologists and chemists alike. However, we must question, who was the first to discover DNA, and what scientists have done to further enhance our understanding of it....   [tags: Biology Medical DNA] 1021 words
(2.9 pages)
Strong Essays [preview]
DNA Sequences Occurs at Many Scales within Genomes Discussion - Today it is widely believed that there are two fundamental ways in which genomes evolve; namely evolution by (1) duplication of pre-existing regions of DNA within the genome and (2) lateral gene transfer. (Brown, 2002), (Zhaxybayeva & Doolittle, 2011). The focus of this essay will be on DNA duplication, its occurrence, and it’s consequences in genomes at a molecular and organismal level. DNA duplication refers to the process by which a region of DNA already present in an organism’s genome is duplicated in that organism....   [tags: chromosomes, dna duplication, genome evolution]
:: 17 Works Cited
2283 words
(6.5 pages)
Term Papers [preview]
Against Proposition 69 and the DNA Fingerprint Act - Abstract: California’s Proposition 69 and the DNA Fingerprint Act both expand criminal DNA databases far beyond what is necessary to protect citizens and prosecute violent crime. DNA profiling techniques and databases have developed largely over the last fifteen years, and the recent expansions are only a part of an ongoing trend of ‘function creep’ that characterizes database expansion. Proposition 69 and the DNA Fingerprint Act expand DNA databases originally designed to house DNA samples from violent criminals to include samples from anyone arrested for a felony crime....   [tags: DNA Database Crime Criminals]
:: 4 Works Cited
1711 words
(4.9 pages)
Powerful Essays [preview]
DNA and DNA Profiling Made Simple - ... It only requires keen scrutiny of the crime area to obtain these materials. Above all, the isolation of cellular material from these components provides enough DNA that helps in solving crime puzzles. In addition, the victim of a crime has extremely high chances of carrying DNA evidence. The places where DNA isolation occurs in criminal investigations include tissues, cigarettes, clothes, stamps, cups, weapons, and bite marks among other places. The collection process proceeds after the identification of the material evidence with DNA....   [tags: genetic analysis and research]
:: 15 Works Cited
3447 words
(9.8 pages)
Research Papers [preview]
The Discovery of DNA - ... According to Norah Rudin, through a series of experiments in the 1900s, it is found that DNA, similar to a fingerprint, are unique. No two DNA are alike, which makes it perfect for identification, hence the term “DNA fingerprinting” (7). Through a small amount of DNA, we are able to identify an individual through comparing with other DNAs. Criminal justice systems all around the world had benefitted from DNA fingerprinting, which had been able to prove suspects guilty with a significant percentage of accuracy....   [tags: biological identification, fingerprinting] 734 words
(2.1 pages)
Strong Essays [preview]
DNA in Forensics - ... They must always wear gloves, mask, and use disposable instruments. This help prevents the DNA being contaminated, to where it would not be useable. The collected samples must be bagged and label in envelopes but not plastic bags. Plastic Bags retain moisture that will damage DNA, another reason why DNA must be protected and label is that direst sunlight and weather condition may damage DNA. To further help protect the collect DNA, chain-of-custody is set up to transport collected evidence to be analyzed....   [tags: works, chromosomes, cell, genetics]
:: 8 Works Cited
801 words
(2.3 pages)
Better Essays [preview]
Overview of DNA - DNA (deoxynbonucleicacid) is a sensational object. It defines what an organism is, it is what makes a human a human and not a medusa that thrives in tropical oceans. If a human's DNA were to be unraveled, it would reach 140 astronomical units and would be able to go to the moon and back more than 6000 times. Yet, every single organism- viruses are not exceptions - has some amount of DNA, however minute. DNA and genetics have bafiled people for millermia. Civilizations have peaked and plmnmeted for the many years when DNA was completely obscured from even the minimal knowledge....   [tags: Biology, Science]
:: 5 Works Cited
1864 words
(5.3 pages)
Good Essays [preview]
DNA is Everywhere - ... This is a chromosomal disorder meaning “an abnormal condition due to something unusual in an individual's chromosomes.” Turner Syndrome is due to a chromosome mutation rather than a gene mutation. The missing X chromosome affects the development of the female. Usually Turner Syndrome is not inherited from the parent and “occurs as a random event during the formation of reproductive cells in the affected person's parent.” Sometimes the egg loses a sex chromosome as a result to nondisjunction and in this case resulting in Turner Syndrome....   [tags: inherit, chromosome, syndrom] 532 words
(1.5 pages)
Research Papers [preview]
Taking a Look at DNA Cloning - ... Blunt ends are usually undesirable because DNA ligases will yield a lower amount of recombinant DNA while using blunt ends. There is also a disadvantage of inserting the insert DNA in an opposite orientation. The other type of end, usually the more desirable one, is called the sticky end. The sticky end contain an overhang after cleavage. The overhang is a stretch of an unpaired nucleotide at the end of the DNA molecule. These unpaired nucleotides can create 5’ and 3’ overhangs. In most cases, these overhangs are palindromic....   [tags: genetic engineering and manipulation] 1254 words
(3.6 pages)
Research Papers [preview]
Significance of Discoveries in Genetics and DNA - ... As the two strands separate the biological information is replicated in which a siginificiant portion of the DNA being non-coding, simply translated that these sections do not serve a function of encoding proteins. DNA gives an organism its traits through protein synthesis. Protein synthesis, or protein biosynthesis, is the process by which biological cells generate new proteins which is balanced by the loss of cellular proteins by degraduation or export. DNA, is a genetic material present inside the nucleus which has the information that helps in the synthesis of RNA and proteins....   [tags: organism, proteins, traits]
:: 3 Works Cited
522 words
(1.5 pages)
Strong Essays [preview]
What is DNA? Where is it found? - ... Article can be related through chapter 6 (DNA structure and function) in which we discuss about “DNA is the genetic blueprint for our cells. It contains the complete set of “instructions” necessary for you to exist. While it is true that everyone is unique due to his or her DNA, it is interesting to note that all DNA is composed of the same subunits. At first glance, the structure of DNA can seem complicated, but the structure becomes simplified when you consider that DNA consists of three basic subunits: deoxyribose sugars, phosphate groups, and nucleotides”....   [tags: cells, mitochondria, human body] 676 words
(1.9 pages)
Better Essays [preview]
The Fallibility of Partial DNA in Courts - ... Many labs do not have the funding or staffing for the amount of work they have (Hansen 1). Understaffing leads to less people having to fulfill a workload that is over their capacity, which easily can lead to error. DNA testing is proven to take concentration and with understaffing at forensic analysis labs, it could easily result in workers rushing through the test to meet the high volume. Also troubling, labs under law enforcement agencies are subjected to pressure to produce the results police are looking for (Hansen 1)....   [tags: Deoxyribonucleic Acid, society]
:: 5 Works Cited
1582 words
(4.5 pages)
Research Papers [preview]
The Pros and Cons of DNA Fingerprinting - DNA fingerprinting is one of the greatest identification systems we have to-date to recognize an individual or living organism. Every living creature is genetically different in its own way, except in the rare case of twins, triples, etc. DNA is the serial number for living things, and is a combination of four nucleotides (thymine, cytosine, adenine and guanine). (Robertson, Ross, & Burgoyne, 2002) Each individual contains a unique sequence that is specific to that one organism. There are many advantages to DNA Fingerprinting ranging from early detection of hereditary diseases to convictions of criminals....   [tags: criminal identification systems] 589 words
(1.7 pages)
Good Essays [preview]
DNA Fingerprinting in Criminal Investigations - ... It is analyzed by the length of DNA, which include repeating base pairs. The repeating base pairs are known as variable number tandem repeats or VNTRs. The number of repeats will affect the length of each strand of DNA. They are then compared with the sample; RFLP requires a large sample of DNA that has not been contaminated with dirt (3). Many laboratories are replacing RFLP analysis with short tandem repeat (STR) analysis (1). This method has many advantages that RFLP does not have; the biggest of these advantages is the fact that a smaller samples is needed to be able to analyze the samples....   [tags: technology, genetics and criminology]
:: 3 Works Cited
731 words
(2.1 pages)
Better Essays [preview]
A Brief Look at DNA Profiling - ... If DNA profiling is accurately performed it can very well help eliminate individuals, who are obviously not a match. DNA profiling can be absolutely valuable to those who are unjustifiably or deceitfully incriminated. According to an article by Rob Weekes, “An FBI study indicates that since 1989 DNA evidence has excluded the primary candidate in twenty-five percent of sexual assault cases. Moreover, forensically valuable DNA can be found on evidence that has existed for decades, and thus assist in reversing previous miscarriages of justice (Nicole, 2010)....   [tags: crime solving, criminology] 1376 words
(3.9 pages)
Research Papers [preview]
The Human Genome and DNA Sequencing - ... Firstly dimethyl sulphate selectively attacks purines (Adenine and Guanine) or Hydrazine selectively attacks pyramidines (Cytosine and Thymine) by breaking the glycosidic bond between the base and ribose sugar. *show fig* The piperdine catalyzes the phosphodiester bond cleavage where the base has just been removed. *show fig* Fragments of this cleavage are resolved by size using polyacrylamide gel electrophoresis. Sanger Sequencing In the Sanger method, also called the Chain- termination method, the DNA molecule is firstly denatured using heat so that the DNA splits into its template strand and a complementary strand....   [tags: biology, genetics] 1341 words
(3.8 pages)
Research Papers [preview]
The Applications of DNA Typing - DNA Typing has become more present in the world with the creation of new technology, allowing justice to be served in courtrooms, helping to identify bodies after major devastating events have occurred, and also in processes that the average human does not pay much attention to such as the production of biofuels. The process of DNA Typing is not easy considering the fact one must first go through the multi-step process of DNA extraction. Along with DNA Typing also comes the job opportunities that are available, the organizations that have been created in respect to this subject, and the average salary that is available to people who hold a job in this field of work....   [tags: forensic scientist, biological technician]
:: 13 Works Cited
1632 words
(4.7 pages)
Powerful Essays [preview]
DNA: The Basis for Sustaining Life - ... With so many different chromosomes, there are an infinite number of variations that two parents can make-up. Also, the DNA of each person details a variety of information to include how long you are likely to live. All of the chromosomes that make up our DNA are coiled up inside the nucleus of eukaryotic cells. Aside from the reproductive cells, each and every cell contains the 46 linear chromosomes. Of those 46, there are 23 pairs of chromosomes. Of those 23, 22 are similar in size, shape and even genetic content....   [tags: genetic science]
:: 4 Works Cited
1323 words
(3.8 pages)
Term Papers [preview]
The Effectiveness of DNA Profiling in Forensics - Forensics has been greatly enhanced by technology. DNA profiling is one of the technologies that has influenced efficiency and credibility of forensic evidence. The FBI first started using DNA in one of its cases in 1988. In Europe, the United Kingdom opened a DNA database in 1955 (Milena, 2006). The main use of the DNA is to compare the evidence collected at crime scene with the suspects. In addition, it helps to establish a connection between the evidence and the criminals. The investigations have been simplified through the use of technology and DNA has been one of the most effective methods in investigations....   [tags: Forensic Evidence, Technology]
:: 6 Works Cited
669 words
(1.9 pages)
Better Essays [preview]
The Collection and Retention of DNA - Introduction DNA testing has been the center of attention in many criminal justice cases. The United States corrections centers have utilized the DNA testing process. Seventeen death row inmates have been exonerated by the use of these tests. Earl Washington was convicted of rape and murder in 1984. Although he confessed to the rape, he was also diagnosed as being mentally retarded. In October of 2000 Mr., Washington was given a DNA test and was excluded as the rapist and murderer. The Virginia Governor pardoned Mr....   [tags: Uses, Technology, Benefits, Drawbacks]
:: 17 Works Cited
1308 words
(3.7 pages)
Strong Essays [preview]
The Discovery Of The Structure Of DNA - James Watson and Francis Crick discovered the structure of DNA, but only by drawing on the work of many scientists who came before them. (Maddox, 2003) In 1944, Oswald T. Avery, Colin M. MacLeod, and Maclyn McCarty published “Studies on the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types”, which was the first scientific work to identify DNA as the molecule that carried genetic information, and became a breakthrough at that time. (Avery, Macleod, & McCarty, 1944) Before Avery and coworkers published their paper, there was very little interest in DNA among scientists in the field of genetics....   [tags: Genetics]
:: 7 Works Cited
1520 words
(4.3 pages)
Powerful Essays [preview]
Taking a Look at DNA Supercoiling - ... Some Physicists have formed a theory, which states that quantum entanglement holds DNA molecules together and prevents the DNA from falling apart. Quantum entanglement is the relationship between any objects that deal with quantum mechanics. A Physicist named Elisabeth Rieper, from the National University of Singapore, did an experiment to check if there is a connection between DNA and quantum entanglement. Elisabeth Rieper, along with other physicists, created a DNA model made up of a positively charged nucleus surrounded by electrons....   [tags: quantum physics and genetics] 699 words
(2 pages)
Research Papers [preview]
Forensic Use of DNA Technology - ... I predict that if there is no suspect matching the crime evidence, then their DNA was not left at the time. The DNA fragment of the analyzed suspects should match the fragment of the collected evidence,to show that the suspect in question is the original owner of the DNA. The research methodology. When gathering DNA evidence, any physical evidence can be a tangible object that can connect a suspect to a crime scene. A good example is a biological evidence. They contains DNA, hence, is a physical evidence....   [tags: crime, violence, evidence] 1317 words
(3.8 pages)
Better Essays [preview]
Recent Uses of DNA Technology - Recent Uses of DNA Technology DNA, Deoxyribonucleic Acid, is the basic structure for all life, it is the blueprint, the instruction manual, on how to build a living organism. DNA is made up of four nitrogen bases, adenine, thymine, cytosine, and guanine which are connected by sugar-phosphate bonds. Through a process called Protein Synthesis, the nitrogen bases are the code for the creation of amino acids. Essentially, DNA makes amino acids, amino acids make proteins, proteins make organisms. This process has been taking place for much longer than scientists have been able to document....   [tags: Medical Research]
:: 7 Works Cited
1014 words
(2.9 pages)
Strong Essays [preview]
Chemistry and the Structure of DNA - ... The backbone of the nucleic acids consists of the interaction between phosphate groups and the hydroxide groups of nucleic acids. These are held together by covalent bonds called phosphodiester bonds. The helix itself is held together by hydrogen bonds. Although hydrogen bonds are weak individually, there are so many of them within DNA that the strands are held tightly together. Without basic chemistry the structure of DNA would be a mystery. The instructions to make a protein are coded by DNA....   [tags: function, protein, products] 599 words
(1.7 pages)
Good Essays [preview]
Overview of the Importance of DNA - Discoveries in DNA, cell biology, evolution, and biotechnology have been among the major achievements in biology over the past 200 years with accelerated discoveries and insight’s over the last 50 years. Consider the progress we have made in these areas of human knowledge. Present at least three of the discoveries you find to be the most important and describe their significance to society, heath, and the culture of modern life. DNA (deoxyribonucleic acid) is a self-replicating molecule or material present in nearly all living organisms as the main constituent in chromosomes....   [tags: biology, evolution, biotechnology]
:: 8 Works Cited
1575 words
(4.5 pages)
Powerful Essays [preview]
Questions and Anwers on DNA and Molecules - ... Whereas the transposons(jumping genes) normally splice themselves in and out of the genome which they are helped by the enzyme transposase.Retropseudogenes and Pseudogenes (which are termed dead) that are found in the genes, so they do not have use,but unlike pseudogenes, the retropseudogenes after being processed lack introns, that are produced by transcripase,then lastly retrotransposons which are transcribed into mRNA and encodes to reverse transcriptase, will then function into coping the mRNA back to the DNA and incorporates back to the genome (Professor B....   [tags: eukaryotes, genomes] 2593 words
(7.4 pages)
Strong Essays [preview]
Taking a Look at DNA - ... It guides the cell in making new proteins that determine our traits or characteristics (how stuff works). DNA also reproduces and replicates itself. DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same. Each of the sides of DNA runs in opposite directions. During DNA replication, DNA unwinds so it can be copied. This structure can unzip down the middle and each side can serve as a pattern or template for the other side....   [tags: genetic research and engineering] 1735 words
(5 pages)
Research Papers [preview]
Structure of Nucleotides and DNA - ... 1. The double helix is untwisted and the corresponding stands are unzipped. 2. The hydrogen bonds between the bases are broken freeing the floating nucleotides join with nitrogenous bases forming hydrogen bonds. This part of the reason for complementary base pairing. 3. Once the new nucleotide are bonded together by the enzyme DNA polymerase, which form complete strands opposite the original strands. 4. Finally, all the nucleotides are joined to form a complete polynucleotide chain using DNA polymerase....   [tags: deoxyribonucleic, molecule, bond] 1142 words
(3.3 pages)
Better Essays [preview]
DNA: The Continuity of Life - Write an essay explaining the continuity of life and how it is based on heritable information in the form of DNA and its transmission from one generation to another. Life's continuity is based on the unremitting passage of inherited information that takes the form of DNA. This essay extensively examines the fundamental processes that allow for the transmission of DNA and thus life. It initially identifies how information essential for life is stored in DNA and then explains the processes of DNA replication, Mitosis and Meiosis....   [tags: rna, lipids, proteins] 1574 words
(4.5 pages)
Term Papers [preview]
DNA: Exploring Creation With Biology - DNA is the basic substance in the life forms you see around you, yet it is a complicated concept. Your DNA determines the color of your eyes, skin, hair and enable functions such as your sight and hearing. DNA stands for Deoxyribonucleic Acid which contains the biological aspects that make everyone individually different. DNA is all contained in one molecule, and there are millions of tightly packaged DNA cells all throughout many life forms making it the building block of the DNA. In the late 1860’s, a Swiss chemist named Friedrich Miescher first identified DNA....   [tags: Deoxyribonucleic Acid, Scientists, Studies]
:: 6 Works Cited
1053 words
(3 pages)
Strong Essays [preview]
Legal Aspects of DNA Fingerprinting - Does DNA fingerprinting and modern genetic research encroach on the rights of the dead. Introduction: DNA fingerprinting and modern genetics are used to help historians, palaeontologists and archaeologists to research the evolution of mankind. The question that comes to mind is whether or not dead people have any rights when it comes to research. What is DNA fingerprinting. DNA fingerprinting is a way of getting a person’s identification. This is shown in Figure 3 on page 4. One can extract DNA from hair, nails, blood, skin or even saliva....   [tags: genetic research essays]
:: 6 Works Cited
2004 words
(5.7 pages)
Term Papers [preview]
Isolating the DNA of Strawberries - ... Then in 1860 framers in America started planting them.But the first strawberries where picked in the forests and in ancient rome was used to make medicine. Strawberries are usually planted using the plasticulture method. This method is when people build large beds of soil and cover them with plastic and adding seeds and making holes so the seed can grow. The plastic will prevent weeds and erosion. In the beds they would implant tubes that export water to the strawberries. Framers pick strawberries every other day to maintain top quality....   [tags: genetic sciences and research] 712 words
(2 pages)
Better Essays [preview]
DNA Testing in Crime Scenes - ... This type of analysis allows smaller degraded pieces of DNA to still be successfully tested (Lyman, 2014) . There are several steps taken when analyzing DNA in forensics. When testing scientists must first isolate the DNA so it is not contaminated and can't be used. Lab technicians the take small pieces of the DNA, conserving as much as they can encase they need to test again. Once testing is done the next step is determining the DNA test results and finally there is the comparison and interpretation of the test results from the unknown and known samples to determine whether the known individual is not the source of the DNA or is included as a possible source of DNA (USA.Gov, 2012) ....   [tags: Evidence, Cases]
:: 4 Works Cited
572 words
(1.6 pages)
Better Essays [preview]
Patented DNA: An Ethical Issue - Case Study - Background In the United States, if someone needs to have a DNA test done, there is a possibility that it has been patented by a DNA research company. The problem with this is that it can raise the cost of a DNA test from about two hundred dollars, to over two thousand, depending on the test being done. Up to forty-one percent of the genes in your body are actually owned by another company, and are not legally owned by yourself. In particular, Myriad Genetics holds a patent in the BRCA1 and the BRCA2 gene, also owning at least fifteen nucleotides of BRCA1....   [tags: Research, Company, Bioethics] 2507 words
(7.2 pages)
Powerful Essays [preview]
The DNA of Relationships by Gary Smalley - ... When I will be open to people that would have problems, I will help the person, but not the problem. Second, I was aware that I couldn’t force the other person to change. The statement stood out to me about how I cannot change people or even their personalities because they are not me Eckerley 2 and I cannot be them. The statement also interacted me that I should not change the people around me for personality, but for faith. From here, for fitting into my understanding my faith, I cannot change people and their personalities, but I can change their faith by sharing my faith and spreading the Gospel....   [tags: book review] 674 words
(1.9 pages)
Better Essays [preview]
Azacitidine are DNA Methyltransferase Inhibitors - ... This betters the bone marrow production of normal blood cells. Discovery: Azacitidine was first synthesized by Piskala and Sorm in 1964 [Piskala A, Sorm F. (1964). Collect Czech Chem. Commun., 29: 2060-2076]. It was developed as a nucleoside antimetabolite specifically used for the treatment of acute myelogenous leukemia (Cihak, 1974;Sorm et al., 1964). But studies later revealed that this drug inhibited cell mitosis with high dosage which meant the inhibition of DNA synthesis. The drug was lethal to cells in the S-phase causing considerable chromosomal damage PMID: 5487064 resulting in the formation of heritably demethylated DNA http...   [tags: chemotherapeutic drug, cancer, blood cells] 632 words
(1.8 pages)
Research Papers [preview]
The Role of DNA in Cloning - Have you ever thought that science can advance rapidly to a great extent. Nowadays scientists are trying to make the same exact copy of your DNA. Can you imagine having a clone of yourself, your parents, or even your siblings. Have you ever wished for someone to take your place for a minute, an hour, or a day. This may come true one day. According to the Online Dictionary; a clone is defined as “a cell, cell product, or organism that is genetically identical to the unit or individual from which it was derived.” I always thought that cloning was impossible, and is just science fiction....   [tags: Genetic Cloning, Genetics, Genes] 812 words
(2.3 pages)
Better Essays [preview]
DNA Donation: A Personal Choice - Moral choices, ethical dilemmas, personal biases, and strong opinions tend to go hand in hand; you certainly cannot have one without the other. The topic of this paper is an ethical dilemma that will cause me to make a moral choice; I am also personally biased and strongly opinionated in regards to the situation. The topic is the donation of my DNA for a research study; the goal of the study will be to find a variant of a gene that will resist specific bacterial diseases. If the company succeeds in finding this gene, it may be able to produce a drug to sell to people who have these diseases....   [tags: Medical Ethics ]
:: 5 Works Cited
1340 words
(3.8 pages)
Strong Essays [preview]
Genetic Testing or DNA Testing - ... Furthermore, people test to understand how high of a risk their children currently have or will have of inheriting the same disease or disorder. Prenatal screening is when a baby gets screened before it has been born. Screening the baby before birth allows doctors to come up with dietary and medical restrictions as well as shape the lives of children that test positive for a disease or disorder. Doctors do this so that the child will have the least possible chance of developing a disease. Prenatal screening has become more recognized for the good it does....   [tags: deffects or mutations, genetic disorder]
:: 6 Works Cited
724 words
(2.1 pages)
Better Essays [preview]
The DNA Replication Process - All living things on earth are made up of cells that contain DNA. Deoxyribonucleic acid or DNA is the genetic material of living things that can be found in the nucleus of the cells (Alcamo, 1996). It contains the genes and the genetic codes that contain the information that are essential for life’s functions which are passed from generations to generations. DNA composes of two polynucleotide chains twisted around each other in the form of a double helix. According to Alcamo (1996), each strand of the DNA double helix can act as a template for the synthesis of a new complementary strand as it contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its p...   [tags: genetic material of living things]
:: 5 Works Cited
1143 words
(3.3 pages)
Strong Essays [preview]
Transgenic Animal with Human DNA - ... Transgenic animal with human DNA can benefit humans by utilising transgenic animals as disease models (Armao 2013; Bemis & Jo 2011; Martin & Caldwell 2011; Wolchover 2011). AIDS mouse, alzheimer's mice, oncomouse and transpharmers animal are some transgenic animals that are used as disease models (Martin & Caldwell 2011). According to Susan Wilson, associate director of Sanders University Animal Care, animals are modified by inserting human disease gene into an animal for the animal to be studied as disease models (Armao M 2013)....   [tags: selective breeding, animals rights] 575 words
(1.6 pages)
Strong Essays [preview]
Procedure for Isolating Genomic DNA - ... Allele specific PCR primers і)rs9818870 Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product 1 F1.3 5'--- GCT GCTTGGTGCCTCTCTGATAC---3' C/T 61.5 61.2 667bp 2 F2.3 5'--- GCTGCTTGGTGCCTCTCTGATAT ---3' C/T 60.4 61.2 667bp 3 R3 5'--- CGAGGTAGGAACACAGCACA ---3' C/T 58.2 61.2 667bp ii)rs2258287 Sr no. Primer Sequence dbSNP Base pair position Tm Ta Product 1 F1.11 5'--- CGTCATGAAGGAGGCTTGATAACG ---3' G/T 58.8 578bp 2 F2.11 5'--- CGTCATGAAGGAGGCTTGATAACT ---3' G/T 57.6 59.4 578bp 3 R11 5'--- ACTGCTCTTGGCAACAACCT---3' G/T 58.2 578bp Table 2.7....   [tags: blood, gel, ethanol] 1239 words
(3.5 pages)
Strong Essays [preview]
DNA and Crime Investigation - DNA is deoxyribonucleic acid, which is found in almost all living things. DNA serves as a code for the creation and maintenance of new cells within an organism. Within humans, it is found in almost every cell. Although most of our DNA is found within the nucleus of our cells as nuclear DNA, a very small amount of our DNA is also found within the mitochondria as mitochondrial DNA. Because mitochondrial DNA is generally not used for solving crimes, for the purpose of this paper it will be disregarded....   [tags: Criminal Justice Essays]
:: 13 Works Cited
2148 words
(6.1 pages)
Better Essays [preview]
DNA Sets You Free - DNA Sets You Free In America, you are guilty unless proven innocent. There have been people who have been falsely accused and convicted of heinous crimes they did not commit before DNA was discovered. One movie called Conviction is based on a true story how DNA proved a man’s innocence for a heinous crime. There is statistics and facts of how people were convicted for crimes they did not commit before DNA was discovered. Officials use DNA for their databases to identify people; investigators use DNA to solve crimes....   [tags: Crime, Justice System, America, Innocent, Gulity]
:: 3 Works Cited
1377 words
(3.9 pages)
Strong Essays [preview]
What are DNA Vaccines? - ... This type of vaccination is limited to pathogens with molecules that trigger an immune response (Anonymous, 2014). These vaccines could eventually also corrupt normal cellular processes (Anonymous, 2014). The injection of foreign DNA could affect the cells normal protein pathways (Anonymous, 2014). Also when introduced to a DNA vaccine, the body might have an immune response against the DNA, which would destroy the vaccine completely (Anonymous, 2014). Recently, DNA vaccines have been rapidly developing (Anonymous, 2014)....   [tags: Genetics, Trials, Research] 1137 words
(3.2 pages)
Better Essays [preview]
DNA Sequences and Species Boundaries - Discussion The use of genetic markers has been an effective way to examine population structure (Bucklin and Kocher 1996) and mitochondrial DNA sequences have been used broadly to delimit species boundaries (Wiens 1999) . More recently the use of mitochondrial DNA sequences has been contentious, and two extreme viewpoints have emerged (see review in Rubinoff and Holland 2005), one position criticizing the exclusive use of mtDNA while others have endorsed one particular gene (cytochrome c oxidase subunit I) as a universal marker....   [tags: Biochemistry] 2450 words
(7 pages)
Powerful Essays [preview]
Three Experiments Regarding DNA - Experiment #1 James Watson, Maurice Wilkins, and Francis Crick joined together for the finding of the structure of DNA, or deoxyribonucleic acid. Wilkins and Rosalind Franklin used X-ray diffraction to study DNA through its images, and it was on April 1953 that they finally published the discovery of the structure of DNA; they discovered how the hereditary information is coded on the DNA as well as its replication. Watson found out from Franklin’s lectures that DNA existed in two forms of ways, which depended on the humidity of the air....   [tags: Biology, Protein, Bacteriophage] 522 words
(1.5 pages)
Good Essays [preview]
DNA Replicaiton Cause Cancer - ... Diet also lead people to cancer, consumption of red meat in big amount with specific amount of time could lead to intestine cancer. Nitrates and nitrites in meat interfere botulinic exotoxin production in the body (Divisi, Tommaso, Salvemini, Garramone, Crisci, 2006). People who are obese have a higher risk of cancer than the normal people are. V. Treatment People with cancer must be treated with particular treatment as it’s a state where they could be really sensitive about themselves and about the disease, cancer not only makes people down physically but also attack people’s mentality....   [tags: oncological analysis]
:: 6 Works Cited
1551 words
(4.4 pages)
Term Papers [preview]
DNA Replication and Heterochromatin - Heterochromatin is a tightly packed DNA region where genes in such regions are usually not transcribed. Numerous transposable elements (TEs) and repetitive DNA are found in heterochromatic regions. As they can transpose along the genome and disrupt gene functions, it is essential to repress such TEs and DNA repeats (Lippman et al., 2004). Heterochromatin is able to maintain internucleosomal interactions as well as chromatin fiber interactions between cis-elements. It can be passed on to subsequent generations and can control gene expressions by inhibiting transcription epigenetically, a process known as silencing....   [tags: anatomy, heterochromatin]
:: 13 Works Cited
1263 words
(3.6 pages)
Strong Essays [preview]
DNA and Gene Sequencing - DNA and Gene Sequencing Introduction DNA and Gene Sequencing began in the mid-1970s. At this time, scientists could only sequence a few pairs of genes per year. They could not sequence enough to make up a single gene, much less the whole human genome. (DNA Sequencing) Beginning in the 1990s only a few labs had been able to sequence a mere 100,00 gene bases and the costs for sequencing were extremely high. Since then improvemetns in technology have incresed the speed and decresed the cost of gene sequencing to the point where some labs have sequenced well over 100 million DNA bases per year....   [tags: bioengineering, costs]
:: 7 Works Cited
1603 words
(4.6 pages)
Powerful Essays [preview]
DNA Hydroxymethylation of Mammals - Epigenetic changes refer to mechanisms which alter gene expression without altering the underlying DNA sequence. Sometimes, these changes are inherited throughout the cell’s life via cell division. Mechanisms that induce epigenetic changes include DNA methylation, histone modification, prions (which can be inherited without modifying the genome), and RNA signalling. This paper will focus on DNA hydroxymethylation in mammals. DNA methylation is a postreplicative modification that occurs when a methyl (-CH3) group is added at position 5 of the cytosine pyrimidine ring and “establishes a silent chromatin state by collaborating with proteins that modify nucleosomes.” (Rudolf Jaenisch, 2003)....   [tags: Medical Research]
:: 7 Works Cited
1070 words
(3.1 pages)
Strong Essays [preview]
What is DNA Transcription? - ... In the literature, supercoiling was investigated at different promoters on a plasmid by using a range of topoisomers in order to find out the amount of supercoiling that affects transcription and how it is affected. In the experiment, a plasmid called pSA850 was used to investigate the transcription affects. This plasmid is comprised of multiple promoters that are followed by a transcription terminator that yields sequences in different lengths. Some promoters that were present on the plasmid included lacP, galP1 and galP2, pP, bP, and rP....   [tags: RNA, proteins, polymerase] 541 words
(1.5 pages)
Strong Essays [preview]
DNA Profiling - From cases such as OJ Simpson to Chandra Levy, DNA profiling also called DNA fingerprinting or DNA typing has played a major role in the criminal justice system. The law enforcement community uses DNA profiling to rule out or identify suspects. Unlike hair microscopy, bite mark comparisons, shoe print comparisons, and firearm tool mark analysis, DNA typing has been developed through massive scientific research and has undergone meticulous scientific evaluation (Innocence Project). DNA is a foolproof method of identifying a perpetrator of a crime....   [tags: Forensic Science]
:: 6 Works Cited
1365 words
(3.9 pages)
Strong Essays [preview]
DNA Report - Many people have heard about this mysterious DNA molecule but don’t know much about it (what it is, where it’s located, what it does, etc.) In this report it will state the basics and investigate this mysterious molecule: deoxyribonucleic acid. DNA is a thin chainlike molecule found in almost every cell (Rubenstein, 2006), and is used in developing and functioning all known living organisms (“Wikipedia”, 2009). DNA is a Hereditary Material in a human body, (“U.S. National”, 2009), genomes determine hereditary (Rubenstein, 2006)....   [tags: Biology] 876 words
(2.5 pages)
Strong Essays [preview]
DNA Technologies - The structure of DNA was discovered in 1953 and revealed to the world by James Watson and Francis Crick.1 Since then, there has been a whirlwind of activity and discovery in the fields associated with DNA. We have found that DNA is not only a set of instructions for the body, but that it also contains a lot of information about the individual who “owns” the DNA. As it is rapidly becoming cheaper and easier to process DNA, it is becoming more difficult to make sure that there is adequate legislature to protect members of society....   [tags: Biology ] 1023 words
(2.9 pages)
Strong Essays [preview]
DNA Extraction Experiment - ... Cycle sequencing success was determined by using fluorescent dye labeling. All the clean-up had to be done so the DNA wouldn’t cause any interruption during the capillary electrophoresis using an ABI PRISM © 3500 XL Genetic Analyzer. Electrophoresis tubes which contains a polymer, separates out the fragments of DNA based on sizes. The fragments then pass through a laser which excites ddNTPS. The Analyzer then constructs an electropherogram of those ddNTPS. Then its transfer to this computer software called GENEIOUS, which allows the DNA sequence obtained to be analyzed....   [tags: molecular analyses] 2389 words
(6.8 pages)
Research Papers [preview]
Solving Cases with Forensic DNA Analysis - ... Methods: There are many ways to analyze DNA; some methods require fewer materials than others, but they are all nearly equally effective and will produce similar results. One method for forensic DNA analysis is restriction fragment length polymorphism (RFLP). This method requires that restriction enzymes cut DNA into fragments at certain bases (Petricevic 1/ Panneerchelvam and Norazmi 21). Then, the sliced DNA can be placed into a gel for gel electrophoresis and be subject to an electrical charge so that the negatively-charged DNA fragments can move across the gel according to size ("Forensic DNA Fingerprinting Kit Instruction"/Panneerchelvam and Norazmi 21)....   [tags: genetics, crime, scientists] 988 words
(2.8 pages)
Research Papers [preview]
DNA Testing - The criminal justice system is not perfect. Throughout the process there can be many errors that can result in the incarceration of an innocent person. There are examples of this in the case of Gerald Wayne Davis. Faulty eyewitness testimony and double jeopardy are two of errors that will be reviewed in this case. The focus is the use of unreliable scientific evidence. In the past non-DNA testing of evidence was use to prove guilt or innocence. These tests can be inconclusive and can be used to mislead a jury....   [tags: Criminal Justice]
:: 8 Works Cited
1492 words
(4.3 pages)
Powerful Essays [preview]
Bilogy: DNA Fingerprinting - DNA Fingerprinting When you were born you were given your own DNA. The genetic information you carry is very similar to your parents. Even though you and your parents have very similar DNA you also have genetic differences, one example is your fingerprint no one but yourself will have your unique fingerprint pattern. Police use what is called DNA Fingerprinting to extensively investigate crime scenes. DNA in/on a crime scene can be found through the process of DNA Fingerprinting. Police collect evidence from the crime scene to take in for testing....   [tags: Genetic Information, Fingerprint Pattern]
:: 6 Works Cited
1113 words
(3.2 pages)
Strong Essays [preview]
DNA Repair Mechanism - 1.5 DNA repair mechanism DNA double strand breaks (DBSs) and single-strand breaks (SSBs) occur every day in cells and they are mostly caused by ionizing radiation, ultraviolet light, reactive oxygen species, errors during DNA replication, enzymes during meiosis. The repair of these DSBs and SSBs is essential to maintain genomic fidelity and stability. In order to combat DBSs and SSBs, cells have developed multiple distinct DNA repair mechanisms which detect damaged DNA, signal its presence and promote the repair of the damage (Jackson and Bartek, 2009)....   [tags: biology, oxygen, radiation] 2011 words
(5.7 pages)
Powerful Essays [preview]
Familial DNA Searching - Nowadays, DNA is a crucial component of a crime scene investigation, used to both to identify perpetrators from crime scenes and to determine a suspect’s guilt or innocence (Butler, 2005). The method of constructing a distinctive “fingerprint” from an individual’s DNA was first described by Alec Jeffreys in 1985. He discovered regions of repetitions of nucleotides inherent in DNA strands that differed from person to person (now known as variable number of tandem repeats, or VNTRs), and developed a technique to adjust the length variation into a definitive identity marker (Butler, 2005)....   [tags: Genetics]
:: 10 Works Cited
1418 words
(4.1 pages)
Powerful Essays [preview]
DNA Molecule - Haruan Channa striatus is in great demand in the Malaysian domestic fish market. Therefore, detailed knowledge of the genetic diversity and population genetics of Haruan C. striatus are needed for sound management, conservation, stock identification and successful fishing of the species. Haruan, the local name for the snakehead Channa striatus is an obligate freshwater fish of the family Channidae, which has important economic value as food fish, and has pharmacological properties as well as medicinal value (Mat Jais, 1991, 2007a, 2007b; Rahim et al., 2009; Jamaluddin et al., 2011)....   [tags: Biology, The Mitochondrial Cyt B] 648 words
(1.9 pages)
Strong Essays [preview]
How DNA Helps to Solve Crimes - Deoxyribonucleic acid (DNA) has been used to analyze and prove innocence or guilt of suspects of crimes with great accuracy. DNA is part of everyday life. It is the heredity material in humans and almost all other organisms. While being part of an investigation. DNA has helped to solve crimes. There is a couple ways that DNA left behind can be tested to solve a crime. Either if the suspect has been caught and or had his or her DNA tested, or if he or she has left behind any biological evidence. Which then needs to be tested to see if it matches the DNA found in the crime scene to his or hers DNA....   [tags: criminal justice] 565 words
(1.6 pages)
Good Essays [preview]
Gel Electrophoresis: Separating DNA and RNA - ... This is heated in a microwave so that the agarose melts into the buffer. The heated mixture is then poured into the gel mold. When the mixture starts to cool, it undergoes polymerization. This is when the sugar polymers crosslink with each other, causing the solution to form a semi-solid matrix (Molecular Biology CyberLab). The more agarose that is used and dissolved, the firmer the gel will be. Typical concentrations used are between 0.3% to 2% (Buckingham, 2012). The concentration depends on the type of analysis needed....   [tags: laboratory procedures]
:: 7 Works Cited
856 words
(2.4 pages)
Better Essays [preview]
Pros and Cons of Recombinant DNA Technology - Introduction – A historical overview The history of rDNA technology dates back to 1865 when Gregor Mendel, using the pea plant demonstrated and proved some of the basic laws of genetics such as 1) Law of segregation, 2) Law of independent assortment and 3) Law of dominance. Mendel laid the foundation for genetics upon which experiments were conducted in later years. Later in 1915, T.H. Morgan established the fact that chromosome contains genes and these genes are linked through inheritance using Drosophila as a model organism....   [tags: anatomy, RNA]
:: 6 Works Cited
1213 words
(3.5 pages)
Strong Essays [preview]

Your search returned over 400 essays for "DNA"
1  2  3  4  5    Next >>