Wait a second!
More handpicked essays just for you.
More handpicked essays just for you.
Case study on gel electrophoresis
Essay of gel electrophoresis
Essay of gel electrophoresis
Don’t take our word for it - see why 10 million students trust us with their essay needs.
Recommended: Case study on gel electrophoresis
1.0 Introduction
1.1 Zebra Fish
The zebra fish is commonly used for studies involving human diseases. (7). The zebra fish, has a very common genome in relation to humans and serves as a great tool of research for many human diseases. 300 million years separate the zebra fish and the humans last known common ancestor. Shockingly enough their genome is still a great resource for cancer research and many other genetic diseases due to their vast genomic similarities (1). The zebra fish is a model organism in many disease studies such as, cancer, human genetic diseases, neurological disease, Alzheimer’s and many more(8).
1.2 Polymerase Chain Reaction (PCR) and RT-PCR
Polymerase Chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated it is able to be copied as much as needed (2). In this experiment PCR was used to isoloate Vangl2 from Zebra fish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence of DNA (2). In this experiment two primers were used as follows:
5’ GTGCATGTCTTCACCATTGA 3’ 5’ CACATTGTTAGAAGCGGCTGG 3’
5’ CACCACTTGAATGCAGATAGGA 3’ 5’ GTCCACATTGTAGGAGCGGG3’
Also in a PRC reaction, DNA Polymerase is made of many complicated proteins with the function of duplicating DNA before division occurs (2).
Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe expression levels of RNA (10). Using RT-PCR one is capable of identifying a predetermined gene (vangl2) via complementary Deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcribing its cDNA through the enzyme reverse transcriptase (10).
1.3 Gel Electrophoresis.
F...
... middle of paper ...
...udhry B., Copp A.J., Henderson D.J. (2005) “Vangl2 acts via RhoA signaling to regulate polarized cell movements during development of the proximal outflow tract, n.d. Web. 11 March 2014
6. Borovina, Superina, Voskas, Cirunia. (2010) “Vangl2 directs the posterior tilting and asymmetric localization of motile primary cilia, n.d. Web. 15 March 2014
7. Ingham P. (2009) “The power of the zebrafish for disease analysis, n.d. Web. 15 March 2014
8.Wen Z. (2013) “The zebrafish model: use in studying cellular mechanisms for a spectrum of clinical disease entities, n.d. Web. 15 March 2014
9.Bustin SA, Benes V, Nolan T, Pfaffl MW (June 2005). "Quantitative real-time RT-PCR-- a perspective". J. Mol. Endocrinol. Mon. 21 April 2014
10. Bustin SA (October 2000). "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays". J.
It’s important that Zebra Mussels are dealt with great care. Zebra Mussels get their food and energy from filtering water. Nearly a quart can be filtered by and adult Zebra Mussel (“Zebra Mussels,” 2013, para. 5). So if there was an infestation of Zebra Mussels in a lake they could filter a lo...
...ape formation, movement of cardiac progenitor cells, heart tube, and heart function. A novel development of more specific assays, advance genetic screen efforts will provide new knowledge on cardiac development in the following years. Additionally, because of the zebrafish distinct features and its similarities to vertebrae, the zebrafish might become many researchers preferred model organism to study many mammal organs. Recently, the zebrafish has been used to study mechanisms that cause human cardiac and liver diseases and to model human hereditary and developed cardiac diseases. Due to the increase in sequencing efforts, the developing interest to study human liver and cardiac diseases. Also, the increase of resource and the more availability of the zebrafish model used in clinical and basic researchers involved in studying the liver, as well as cardiac diseases
The two modes of analysis that will be used to identify an unknown insert piece of DNA would be plating the transformation cells onto LA plates that have either ampicillin or chloramphenicol and PCR. We will use the PCR thermocycler to denature the restriction enzymes that were specifically used to assimilate the vector DNA. It is important to use the PCR thermocycler because denaturation of the restriction enzyme will prevent the restriction enzyme from cutting the vector DNA, after the insert DNA has assimilated to the vector DNA. After the addition of specific primers that complement the base pair to its corresponding target strand, PCR will be used. Subsequently, Taq polymerase will be used to determine whether the insert DNA has been properly assimilated to the vector DNA. Within this specific situation, the target strand will be the insert DNA. After we let the PCR thermocycler run for approximately 2 ½ hours, we will then put our PCR products in the gel and run the gel to completion. After the gel has run to completion, we will then take a photograph of the gel using the UV transilluminator with the assistance of our TA. If the insert DNA was properly assimilated to the vector DNA, then our corresponding gel photo would have one band. After the cells have been transformed, we would g...
that it added to gene discovery and analysis . . . PCR has made it possible to obtain rapid
...s formation, and hopefully from that gain further understanding of other early embryological processes. These discoveries have also led to an understanding of how axis formation can go wrong, and how to best approach it from a clinical perspective. The current knowledge has raised a lot of questions in regard to the cilia found in the node. How do the cilia know to turn clockwise to beat? Can that be changed to anti-clockwise somehow? What determines their posterior lean? Do all species create a left ward flow in the same way seen in mice? Do they also use cilia, or is there other methods employed by different species? There is still more to be discovered about left-right axis formation, and with the current knowledge and advances in technology, it is hoped that the gaps in the current knowledge are filled to allow for advances in other embryological processes.
PCR is then carried out to amplify each read, creating a spot with many copies of the same read. They are then separated into single strands for sequencing. To sequence, the slide is flooded with nucleotides and DNA polymerase. These nucleotides are fluorescently labelled, with the colour corresponding to the base. They also have a terminator, so that only one base is added at a time.
In the year 1992, she started her research on the developmental genes in the Zebrafish. This is an important fact because without
Laboratory reared wild-type (Tropical 5D) D. rerio were maintained in a recirculating AHAB system (Aquatic Habitats, Inc., Apopka, FL, USA) on a 14:10 h light/dark cycle. Water quality was maintained at 28-29°C, pH 7.0-7.5, and 60 ppm artificial seawater (ASW; Instant Ocean, Foster & Smith, Rhinelander, WI, USA). Adult fish were fed twice daily ad libitum with Artemia nauplii in the morning and Zeigler’s Adult Zebrafish Complete Diet (Zeigler Bros., Inc., Gardners, PA, USA) in the afternoon.
In the next step there is introduction of the four base destruction chemical reactions which are carried out. These are C+T, G, A+G and C. Each of the four base destruction chemical reactions destroys only one base of the sequenced desired DNA molecule. After several reactions are made there is a formation or creation of populations of same sized molecules
Cain, M. L., Urry, L. A., & Reece, J. B. (2010). Campbell Biology. Benjamin Cummings.
However, very little is known about zebrafish biology, including their dietary requirements in wild environments. Diet is a critical factor in controlling health to maintain the population of zebrafish in research and to produce constant results from each individual. Diet can also be a critical contributor to changing physical composition as different diets affect animals differently in terms of body weight and length or height gain. Consequently, if future research uses different diets for the same species of animals, the result may contain unwanted nutritive bias and not account for otherwise controllable variability in these features (Spence, et al. 2007). This paper will review zebrafish diet, specifically covering natural diet, aspects of commercial and formulated diets, and physiological influence of diets
RNA-Seq is technique that allows to quantify gene expession patterns for RNA profiling dependent on NGS (4). Before RNA-Seq methodology has been used, scientists were using Microarray technique for gene expression study (4). RNA sequencing framework enables to examine the presence of all RNAs in a study sample, differentiating their sequences as well as determing their abundances simultaneously. RNA-Seq method takes place to any of many various techniques of NGS applied for gaining whole transcriptome profiles of RNA that can be explored in cell, tissue and other multicellular organisms (5). In addition, all of NGS technologies can be applied for RNA sequencing method. Each of these technologies or aggregation of them have been used as distict RNA-Seq technologies. Despite they share the same concept to produce RNA seq...
Wilkie, I.C. "Autotomy as a Prelude to Regeneration in Echinoderms." Microscopy Research and Technique 55.6 (2001): 369-96. Print.
GloFish are fluorescently labeled zebrafish. These fish are different colors and fluoresce under UV light. Critics have declared that this is an abuse of our knowledge and understanding of transgenic animals. However researches have discovered that when the fish are placed in a contaminated tank with “heavy metal” the GloFish fluoresce. (Klug, 399) These fish have proven to be a bioassay that can determine if a tank is contaminated. Their genetically modified phenotype is an easy to see test result which determines how contaminated the water
The animal I chose to research is a Zebra. A Zebra is a mammal that belongs to the horse family. There are three main species of zebras; Mountain, Plains (Common Zebra) and Grevy’s. A zebra is generally found to live in East and South Africa, A zebra eats plants. Their natural predators are lions, hyenas and other animals. The Grevy’s zebra is the only species that exhibits unique territorial behavior. Courtship behavior is demonstrated when the male zebra displays dominance over the female. In addition, zebras exhibit unique social behavior. The zebra has adapted to its natural environment because of its hearing, eyesight, legs and stomach.